ID: 1048427557

View in Genome Browser
Species Human (GRCh38)
Location 8:134336839-134336861
Sequence CCAGATGGGATTCACACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427548_1048427557 2 Left 1048427548 8:134336814-134336836 CCACACCCTTGCTCCTTGTGTCT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427543_1048427557 25 Left 1048427543 8:134336791-134336813 CCTACTCCCAAATAGGCCACCTG No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427550_1048427557 -4 Left 1048427550 8:134336820-134336842 CCTTGCTCCTTGTGTCTCCCCAG No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427545_1048427557 18 Left 1048427545 8:134336798-134336820 CCAAATAGGCCACCTGCCACACC No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427547_1048427557 6 Left 1048427547 8:134336810-134336832 CCTGCCACACCCTTGCTCCTTGT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427546_1048427557 9 Left 1048427546 8:134336807-134336829 CCACCTGCCACACCCTTGCTCCT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427541_1048427557 30 Left 1048427541 8:134336786-134336808 CCTTCCCTACTCCCAAATAGGCC No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427549_1048427557 -3 Left 1048427549 8:134336819-134336841 CCCTTGCTCCTTGTGTCTCCCCA No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427542_1048427557 26 Left 1048427542 8:134336790-134336812 CCCTACTCCCAAATAGGCCACCT No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
1048427544_1048427557 19 Left 1048427544 8:134336797-134336819 CCCAAATAGGCCACCTGCCACAC No data
Right 1048427557 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427557 Original CRISPR CCAGATGGGATTCACACACC AGG Intergenic
No off target data available for this crispr