ID: 1048427562

View in Genome Browser
Species Human (GRCh38)
Location 8:134336872-134336894
Sequence CCTGAATTCCAGGAGACACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048427554_1048427562 12 Left 1048427554 8:134336837-134336859 CCCCAGATGGGATTCACACACCA No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427556_1048427562 10 Left 1048427556 8:134336839-134336861 CCAGATGGGATTCACACACCAGG No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427553_1048427562 22 Left 1048427553 8:134336827-134336849 CCTTGTGTCTCCCCAGATGGGAT No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427555_1048427562 11 Left 1048427555 8:134336838-134336860 CCCAGATGGGATTCACACACCAG No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427558_1048427562 -8 Left 1048427558 8:134336857-134336879 CCAGGCCTTATGATTCCTGAATT No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427549_1048427562 30 Left 1048427549 8:134336819-134336841 CCCTTGCTCCTTGTGTCTCCCCA No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data
1048427550_1048427562 29 Left 1048427550 8:134336820-134336842 CCTTGCTCCTTGTGTCTCCCCAG No data
Right 1048427562 8:134336872-134336894 CCTGAATTCCAGGAGACACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048427562 Original CRISPR CCTGAATTCCAGGAGACACT AGG Intergenic
No off target data available for this crispr