ID: 1048434446

View in Genome Browser
Species Human (GRCh38)
Location 8:134403030-134403052
Sequence CCAGAAGGCATGGTTCATTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048434446_1048434455 13 Left 1048434446 8:134403030-134403052 CCCCAATGAACCATGCCTTCTGG No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data
1048434446_1048434456 14 Left 1048434446 8:134403030-134403052 CCCCAATGAACCATGCCTTCTGG No data
Right 1048434456 8:134403067-134403089 TGTTGTCTCACACTGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048434446 Original CRISPR CCAGAAGGCATGGTTCATTG GGG (reversed) Intergenic
No off target data available for this crispr