ID: 1048434449

View in Genome Browser
Species Human (GRCh38)
Location 8:134403032-134403054
Sequence TACCAGAAGGCATGGTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048434449_1048434456 12 Left 1048434449 8:134403032-134403054 CCAATGAACCATGCCTTCTGGTA No data
Right 1048434456 8:134403067-134403089 TGTTGTCTCACACTGACTCTGGG No data
1048434449_1048434455 11 Left 1048434449 8:134403032-134403054 CCAATGAACCATGCCTTCTGGTA No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048434449 Original CRISPR TACCAGAAGGCATGGTTCAT TGG (reversed) Intergenic
No off target data available for this crispr