ID: 1048434455

View in Genome Browser
Species Human (GRCh38)
Location 8:134403066-134403088
Sequence ATGTTGTCTCACACTGACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048434451_1048434455 -2 Left 1048434451 8:134403045-134403067 CCTTCTGGTATCCACACCCACAT No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data
1048434449_1048434455 11 Left 1048434449 8:134403032-134403054 CCAATGAACCATGCCTTCTGGTA No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data
1048434448_1048434455 12 Left 1048434448 8:134403031-134403053 CCCAATGAACCATGCCTTCTGGT No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data
1048434446_1048434455 13 Left 1048434446 8:134403030-134403052 CCCCAATGAACCATGCCTTCTGG No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data
1048434450_1048434455 3 Left 1048434450 8:134403040-134403062 CCATGCCTTCTGGTATCCACACC No data
Right 1048434455 8:134403066-134403088 ATGTTGTCTCACACTGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048434455 Original CRISPR ATGTTGTCTCACACTGACTC TGG Intergenic
No off target data available for this crispr