ID: 1048434457

View in Genome Browser
Species Human (GRCh38)
Location 8:134403095-134403117
Sequence TCTGTGACTTAGCACATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048434451_1048434457 27 Left 1048434451 8:134403045-134403067 CCTTCTGGTATCCACACCCACAT No data
Right 1048434457 8:134403095-134403117 TCTGTGACTTAGCACATATGAGG No data
1048434454_1048434457 10 Left 1048434454 8:134403062-134403084 CCACATGTTGTCTCACACTGACT No data
Right 1048434457 8:134403095-134403117 TCTGTGACTTAGCACATATGAGG No data
1048434453_1048434457 11 Left 1048434453 8:134403061-134403083 CCCACATGTTGTCTCACACTGAC No data
Right 1048434457 8:134403095-134403117 TCTGTGACTTAGCACATATGAGG No data
1048434452_1048434457 16 Left 1048434452 8:134403056-134403078 CCACACCCACATGTTGTCTCACA No data
Right 1048434457 8:134403095-134403117 TCTGTGACTTAGCACATATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048434457 Original CRISPR TCTGTGACTTAGCACATATG AGG Intergenic
No off target data available for this crispr