ID: 1048436347

View in Genome Browser
Species Human (GRCh38)
Location 8:134422108-134422130
Sequence TCTGAGCATTACTAGGTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048436347_1048436351 6 Left 1048436347 8:134422108-134422130 CCCTAGACCTAGTAATGCTCAGA No data
Right 1048436351 8:134422137-134422159 TAACAGCTTTGTTGTAGCAAGGG No data
1048436347_1048436350 5 Left 1048436347 8:134422108-134422130 CCCTAGACCTAGTAATGCTCAGA No data
Right 1048436350 8:134422136-134422158 CTAACAGCTTTGTTGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048436347 Original CRISPR TCTGAGCATTACTAGGTCTA GGG (reversed) Intergenic
No off target data available for this crispr