ID: 1048451913

View in Genome Browser
Species Human (GRCh38)
Location 8:134540978-134541000
Sequence CACTGGCACCAGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048451903_1048451913 -1 Left 1048451903 8:134540956-134540978 CCGTGGATCAAGTGGCCCTGCCC 0: 1
1: 0
2: 2
3: 16
4: 371
Right 1048451913 8:134540978-134541000 CACTGGCACCAGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048451913 Original CRISPR CACTGGCACCAGAGGGGAGA GGG Intronic
No off target data available for this crispr