ID: 1048452323

View in Genome Browser
Species Human (GRCh38)
Location 8:134544212-134544234
Sequence AAGGATTTGCAGCCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048452323 Original CRISPR AAGGATTTGCAGCCTGTGGA GGG (reversed) Intronic
900173909 1:1283763-1283785 AAGGGGCTGCAGCCTGTGGAGGG - Intronic
900641903 1:3691569-3691591 AAGGGTCTGCAGCTTGTGGTTGG + Intronic
901413832 1:9103765-9103787 AAGGGTTAGCAGCCCATGGAGGG + Exonic
902264840 1:15255924-15255946 ATGGATTTTCAGCAAGTGGAAGG + Intronic
902707287 1:18214297-18214319 AATGATTTACAGCCTTTGCAGGG - Intronic
903816239 1:26066428-26066450 AGGGATTTGCAGCCTGCAGGTGG + Exonic
906260839 1:44388482-44388504 TAGGATCTACAGCTTGTGGAAGG - Intergenic
906451572 1:45953694-45953716 CAAAATTAGCAGCCTGTGGAAGG + Intronic
906692199 1:47799860-47799882 AAGCATTTGGAGCCTGTGGAAGG - Intronic
907754863 1:57301658-57301680 AATGAAATGCAGCTTGTGGAAGG - Intronic
909028682 1:70513201-70513223 AAGGAGTGGCATCCTCTGGATGG + Intergenic
909547358 1:76862765-76862787 AAGGATTAGGGGGCTGTGGAGGG - Intergenic
910131645 1:83914705-83914727 AGGGATTGGTAGCATGTGGATGG - Intronic
912495834 1:110090595-110090617 ATGGATTTGCAGCATTTAGAGGG + Intergenic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
913082832 1:115404949-115404971 AAGGAAATGCAGCCTTTAGAGGG + Intergenic
913997859 1:143666045-143666067 GAGGATGTGCAGCCTGGGGATGG + Intergenic
914686541 1:149984897-149984919 AAAGAGCTGTAGCCTGTGGAAGG - Intronic
915263644 1:154698285-154698307 AAGGCTTGGCAGCCAGGGGATGG - Exonic
915491791 1:156254134-156254156 AAGGATTTGCATGCTGTTTAGGG - Intronic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
916000994 1:160615600-160615622 AAGGAAATGCACCCTGTGGTGGG + Intronic
916474187 1:165152966-165152988 AAGGATTAGCAGCCAGTTGATGG - Intergenic
917140200 1:171827624-171827646 AAAAATTTGCAGCCTGATGATGG - Intergenic
920946173 1:210530627-210530649 AAGCATTTGCAGACTTTGCACGG + Intronic
921346676 1:214193381-214193403 AAGCATTTGCAGCCTAGGAAGGG - Intergenic
922459308 1:225802791-225802813 GAGGACCTGCAGCCAGTGGAAGG - Intergenic
922727142 1:227927831-227927853 TGGGTTTTGCAGCTTGTGGAGGG - Intronic
1062895507 10:1100328-1100350 GAGGCAGTGCAGCCTGTGGACGG + Intronic
1068892133 10:62159036-62159058 AAGGACTTGCTGCCTGTAGTGGG + Intergenic
1071146449 10:82579412-82579434 AAGGAATTGAAGGCTGTGGAGGG - Intronic
1075650703 10:124127011-124127033 GAGGTTTTGGAGCCTGAGGAAGG + Intergenic
1076929150 10:133517455-133517477 ACGGATTTGCACCCAGAGGAAGG - Intergenic
1077726630 11:4681756-4681778 AAGGACTTGCAGGCTGTGGGAGG - Exonic
1078504010 11:11916156-11916178 AAGGATGTGCAGGCTGGGCATGG + Intronic
1081736538 11:45408450-45408472 AAGGAGATGCAACCTGTGAAAGG + Intergenic
1082096855 11:48137975-48137997 AAGGCTTTGCAGACAGTGGTGGG + Intronic
1083288924 11:61679443-61679465 AAGGAATTTAAGCCTGGGGATGG - Intergenic
1085571974 11:77567942-77567964 AAGGATTTCCAGCCATTCGAAGG + Intronic
1087861332 11:103161228-103161250 ATGGATTTGTAGTCTTTGGAAGG + Intronic
1088209472 11:107438678-107438700 AAAAATTTGCAGTCTTTGGAAGG - Intronic
1089454524 11:118618250-118618272 GAAGCTTGGCAGCCTGTGGAGGG + Intronic
1089940001 11:122406378-122406400 AAGTATTTGCCGTATGTGGAGGG - Intergenic
1091282214 11:134388220-134388242 AAGGTCTTACAGCCTGTGGGTGG - Exonic
1093907428 12:24709666-24709688 AAGGCTTTGTAGGCTATGGAAGG - Intergenic
1094354430 12:29563146-29563168 AAGGATTGACAGGCTTTGGAGGG - Intronic
1095159373 12:38898893-38898915 AAGGATATGCCACCAGTGGATGG + Intronic
1095275567 12:40278662-40278684 ATGGCTATGCAGGCTGTGGATGG + Intronic
1096773520 12:53950899-53950921 AGGGATTTGCAGCCTGGAGGAGG - Intergenic
1103623012 12:122200356-122200378 ACAGAAGTGCAGCCTGTGGATGG - Intronic
1103841966 12:123872297-123872319 AGGGATTTGCAGGCAGTGGGGGG + Intronic
1104739437 12:131162241-131162263 ATGGATGTGCATCCTGTGGGTGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108138873 13:47396963-47396985 AAGGATTTGAAGCTGGTGGGTGG + Intergenic
1111543072 13:89693735-89693757 AAGGACTTTAAGCCTGTGTATGG - Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1111813227 13:93118552-93118574 GGTGATTTGCAGCCTGTGGAAGG + Intergenic
1112938699 13:104833371-104833393 AATGCTTTGGAGCCTTTGGAGGG - Intergenic
1113303218 13:109045766-109045788 AGGGCTGTGCAGACTGTGGAAGG - Intronic
1114053930 14:18949668-18949690 AAGGATTTGCCTACTCTGGAAGG - Intergenic
1114108626 14:19452257-19452279 AAGGATTTGCCTACTCTGGAAGG + Intergenic
1118682224 14:68254346-68254368 ATGGATCTGCTGACTGTGGAGGG - Intronic
1120031091 14:79641720-79641742 AAGGAATTGCTGCATTTGGAGGG - Intronic
1122067063 14:99181276-99181298 AATGTTTTGCAACCTGTAGAGGG - Intronic
1122477856 14:102024083-102024105 TTGGATTTCCAGCCGGTGGAAGG + Intronic
1124019546 15:25906905-25906927 AAAGGCTTGCAGCCTGTGGTGGG + Intergenic
1126322611 15:47441792-47441814 AAGCATTTGTAGCCTGTAGATGG + Intronic
1126606781 15:50485996-50486018 AAGTATTTTCAATCTGTGGATGG + Intronic
1129337845 15:74864401-74864423 AAGGTTATGGAGGCTGTGGAGGG + Intronic
1130963680 15:88681838-88681860 ATGGATCAGCAGCCTGTGGCCGG + Intergenic
1133901087 16:9975510-9975532 ATTTATTTGCAGTCTGTGGATGG - Intronic
1134890031 16:17832682-17832704 GAGTTCTTGCAGCCTGTGGAAGG + Intergenic
1136544478 16:30947838-30947860 AAGGAACTGAAGCCTGGGGAGGG - Exonic
1138454155 16:57111810-57111832 AAAGAGTTGCAGCTTGAGGAAGG + Intronic
1138475848 16:57270316-57270338 AAGGACTTGGGGGCTGTGGATGG - Intronic
1139280591 16:65766996-65767018 AAGGATTTGCAGGCTGGGTGCGG - Intergenic
1140728375 16:77834255-77834277 AAGGACTTGCAGCCTCTGTAAGG + Intronic
1141157746 16:81609191-81609213 AAGGCTTTGCTGGCTGTGGTGGG - Intronic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1143893258 17:10118311-10118333 GAGGATTTTGAGCCTGTGGTTGG - Intronic
1145284667 17:21496282-21496304 CAGGAATTGCAGCCTGGAGAGGG + Intergenic
1145716374 17:27027109-27027131 AAGGAAGTGGAGCCTGTGGATGG - Intergenic
1148335688 17:46839500-46839522 AAGAATTTACAGCCTGTGCATGG - Intronic
1148472941 17:47906857-47906879 ATGAGTTGGCAGCCTGTGGAAGG + Intronic
1148509934 17:48159937-48159959 AGGGATTTGCAACATGGGGAAGG + Intronic
1149549875 17:57532276-57532298 GAGGGGCTGCAGCCTGTGGAGGG + Intronic
1150142291 17:62740253-62740275 AAGCATTTGCAGCATCTGCAGGG - Intronic
1150159491 17:62883781-62883803 AAGGGGTTGGAGCCTTTGGAAGG + Intergenic
1150281237 17:63930756-63930778 GAGGATTTCAAGCCTGTGCAGGG - Intronic
1151178028 17:72305178-72305200 AGGGATTTGAGGGCTGTGGAAGG - Intergenic
1151608075 17:75153258-75153280 AAGGGTTTGGATTCTGTGGAAGG - Intronic
1151911137 17:77084040-77084062 AAGGCTTGGCAGCCTGTGGCTGG - Intergenic
1152842695 17:82580250-82580272 AAGGATCTGGGCCCTGTGGATGG - Intronic
1153452997 18:5250320-5250342 AAGTATATGCAGCCTGTTGAAGG - Intergenic
1154305718 18:13229292-13229314 AAGGCTGTGCAACCTGGGGAAGG + Intronic
1155961119 18:31995743-31995765 AAGGCTATGCAGCTTGTGGGTGG - Intergenic
1157708118 18:49826340-49826362 AGAGATTGACAGCCTGTGGAGGG - Exonic
1157797989 18:50593312-50593334 AAGGATTGCCAGCCTGCAGATGG - Intronic
1166746021 19:45142238-45142260 CAGGATGTGCAGCCTGTTGGGGG + Intronic
925455648 2:4014461-4014483 TAGGAGGTGCAGCCTGTGGGAGG - Intergenic
925705059 2:6676956-6676978 AAGGATTCTCAGACTTTGGAAGG + Intergenic
925814931 2:7738128-7738150 AAAGTTTTGCAGCCTGTGATTGG + Intergenic
925904945 2:8534816-8534838 CGGGATCTGCAGGCTGTGGAAGG + Intergenic
929348483 2:40917668-40917690 TAGGAGGTGCAGCCCGTGGAAGG - Intergenic
931694045 2:64859064-64859086 CAGTATTTGTAGCCTGTAGAAGG + Intergenic
934727210 2:96630833-96630855 ATAGATTTGCAGGCTATGGAGGG - Intronic
935282619 2:101532299-101532321 AAGGTTTTGTAGCCTGTAAATGG + Intergenic
935503205 2:103867889-103867911 AAGTATTTACACCCTGTGGTAGG + Intergenic
935982397 2:108640241-108640263 AAGGACATGGAGCCTGGGGAAGG - Intronic
936324993 2:111497436-111497458 CAGGCTTTGCAGCCTTGGGAAGG - Intergenic
940715399 2:157217834-157217856 AAGGATTTTCAGCCTGGGCATGG + Intergenic
943741008 2:191409157-191409179 AAGGATTTTCCACTTGTGGAGGG + Exonic
946901606 2:224378486-224378508 AAGCATTTGCAACCTGCAGATGG - Intergenic
948061681 2:235047071-235047093 AAAGGGTTGCAGCCTGTGGGTGG + Intronic
948711319 2:239827420-239827442 AAGGCCGTGCAGCCTGTGGCAGG - Intergenic
948997183 2:241587483-241587505 CAGGGTTTCCAGCTTGTGGAGGG + Intronic
1169586590 20:7092570-7092592 AAGGGTTTTCAGGCTGAGGAAGG - Intergenic
1172187968 20:33043218-33043240 AAGGAGTGGCAGCCTGGGGTAGG - Intronic
1172519084 20:35555848-35555870 AGGAGTTTGCAGGCTGTGGAAGG + Intronic
1177812021 21:25934900-25934922 AAGGATTTGTTCCCTGTGGAAGG - Intronic
1179045105 21:37836907-37836929 AAAAATTGGCAGCCTTTGGAAGG + Intronic
1179901207 21:44395729-44395751 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901232 21:44395807-44395829 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901314 21:44396069-44396091 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901430 21:44396430-44396452 AGGGATGTGGAGGCTGTGGAGGG + Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1179901453 21:44396507-44396529 AAGGGTGTGGAGGCTGTGGAGGG + Intronic
1180105882 21:45617764-45617786 ATGGCATTGCAGGCTGTGGAAGG - Intergenic
1180229887 21:46420940-46420962 AAAGATTTGCAGGCGGTGGGTGG + Intronic
1180232873 21:46437808-46437830 AAGGACGTTCAGCCTGTGGAGGG - Intronic
1180472401 22:15672049-15672071 AAGGATTTGCCTACTCTGGAAGG - Intergenic
1180713279 22:17854546-17854568 ATGGATTTCCTGTCTGTGGACGG - Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184752994 22:46499861-46499883 AGGGGTTTGCAGACGGTGGAGGG - Intronic
1184819191 22:46896001-46896023 AAGGATGTGCGGCGTGCGGAGGG - Intronic
949584509 3:5424752-5424774 AAGGATTCGCAGACTGTTCAGGG + Intergenic
949820148 3:8107150-8107172 CAGGATCTGCAGCTTGTAGATGG + Intergenic
951376054 3:21919134-21919156 AAGGATTTACAGAATGTTGAAGG + Intronic
951462103 3:22962646-22962668 TAGGAGGTGGAGCCTGTGGAAGG + Intergenic
951598438 3:24343691-24343713 AAGGATTTGGAGATTGTGGTTGG - Intronic
953237610 3:41120110-41120132 AATTATTTGCAGCCTGTGGGAGG + Intergenic
954094545 3:48314854-48314876 AAGGCCTTGCAGCCAGTGTAAGG + Intronic
954620911 3:51994905-51994927 AAGGAATTGCAGGCTTTGGGTGG + Intronic
955071879 3:55578406-55578428 AAGGAGGTGCAGACTGTGGTAGG - Intronic
955837255 3:63069794-63069816 AAAGATTTGGAGCCTGGGGAGGG + Intergenic
958888473 3:99755847-99755869 TAGGTCTTGCAGGCTGTGGAGGG + Intronic
960926188 3:122796674-122796696 AAGAAGGTGCAGCCTTTGGAAGG - Intronic
961551329 3:127672143-127672165 AAGGATCTGGCACCTGTGGAGGG + Intronic
964402299 3:156311910-156311932 CAGGCTCTGCAGCCTGTTGACGG + Intronic
964626943 3:158768708-158768730 TAGGATTTGCAGCCAGTGTTGGG + Intronic
965538475 3:169849429-169849451 AAGGAATTGCAGCCATTAGAAGG - Intronic
965656608 3:170991941-170991963 AAGGATTAGCAGTCTTTTGAAGG - Intergenic
969484468 4:7464421-7464443 AGGGAGCCGCAGCCTGTGGAGGG + Intronic
970057595 4:11993483-11993505 AAAAATTTGCAGCCTGATGATGG + Intergenic
970161821 4:13196967-13196989 AAGGATTTCCACCCTGGGGAGGG - Intergenic
971473868 4:27054483-27054505 AAGGATTTGCTGGCTTTGGCTGG - Intergenic
971504574 4:27352240-27352262 AGGGATTTGTAGACTGTGGGAGG - Intergenic
972047935 4:34692776-34692798 AGGGATTTGAAGCCTGTGACAGG - Intergenic
972796689 4:42428348-42428370 AAGGAAGAGCAGCCTTTGGAGGG - Intronic
973027706 4:45293404-45293426 AAGATGTTGCAGCGTGTGGAGGG + Intergenic
973797383 4:54441940-54441962 AAGGACATGCAGCCAGTGAAGGG - Intergenic
975735478 4:77377009-77377031 AAGGAATGGCTGCCTGTGAAGGG + Intronic
975739391 4:77414520-77414542 AAGGAATGGCTGCCTATGGAAGG + Intronic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
981009572 4:139911642-139911664 TAGGAGGTGCAGCCTTTGGAAGG + Intronic
982165933 4:152613745-152613767 AATGATCCCCAGCCTGTGGAGGG - Intergenic
983804422 4:171976217-171976239 AAGAATTTGCTGCCTGTGGCTGG - Intronic
984204360 4:176768582-176768604 AAGGATTGGCAGCCCCTGGAGGG - Intronic
984338616 4:178424616-178424638 TAGGAGTTGCAGCCTTTGGGAGG - Intergenic
986401971 5:7391452-7391474 AAGGAGTTGCAGCATGTCAATGG + Intergenic
986798343 5:11233996-11234018 AAGTGTTTGCAGCCTTTAGAAGG + Intronic
988433901 5:31150784-31150806 AAGGATATGCAGCCTTGGGCTGG + Intergenic
989363601 5:40631328-40631350 TAGCAATTGTAGCCTGTGGAAGG - Intergenic
991212120 5:64117987-64118009 AAGGCTTTGCTTCCTATGGAAGG + Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
998416226 5:141948152-141948174 AAGGTTGTGCAGCTCGTGGATGG - Intronic
999456187 5:151718313-151718335 AAGGAACTGCAGCCTGATGATGG + Intergenic
999740202 5:154544143-154544165 GAGGACTTGCTGCCTGTGGTTGG - Intergenic
1001535117 5:172492651-172492673 GAGGACTCCCAGCCTGTGGAAGG + Intergenic
1001726102 5:173901972-173901994 AGGGATTTGCTGCCTGTGTAGGG + Intronic
1001799821 5:174533231-174533253 AAGACTTTGCAGCCTGCGGGTGG + Intergenic
1004026023 6:11819281-11819303 AAAGATCTGCAGCCTGGGCATGG - Intergenic
1004758402 6:18638749-18638771 AAGGAGTTGCAGATTGTGGTGGG + Intergenic
1005677691 6:28172399-28172421 ATGGATGTGGAACCTGTGGATGG - Intergenic
1007090597 6:39182205-39182227 AATGATTTGCAGGCTGGGAAGGG - Intergenic
1010231694 6:73540730-73540752 AAGGATTTGCAGGCTGGGTGTGG + Intergenic
1013434540 6:110089113-110089135 ATTGAATTGCAGCCTTTGGAAGG - Intergenic
1014398800 6:120961424-120961446 AAGGTGTTGCAGCATGTGGGTGG - Intergenic
1014473178 6:121840730-121840752 AAGTATTTCCAGGCTGTGGTAGG + Intergenic
1016309896 6:142723152-142723174 GAGGTTGTGCAGCCTGTGCAGGG - Intergenic
1017136032 6:151148077-151148099 AAGGATTTGAAGGCTGTGAAAGG + Intergenic
1017551246 6:155510368-155510390 AAGGACTTGCAGCCTATACATGG - Intergenic
1017805149 6:157939452-157939474 AAGGATTTGCTGGTTATGGAGGG + Intronic
1022485075 7:30771626-30771648 AAGGCTTTGCAGCTTCTGGGAGG + Intronic
1023566604 7:41529404-41529426 AAGGAATTACTTCCTGTGGAGGG + Intergenic
1023972202 7:44999979-45000001 CAGGATCTTCAGCCTGTGGGCGG + Intronic
1026650610 7:72212920-72212942 AAGGATTTTCTCCATGTGGAAGG - Intronic
1026748865 7:73034089-73034111 AAGAATTTGCAGCCTCCAGAAGG - Intergenic
1026752513 7:73062234-73062256 AAGAATTTGCAGCCTCCAGAAGG - Intergenic
1026756164 7:73090365-73090387 AAGAATTTGCAGCCTCCAGAAGG - Intergenic
1027035062 7:74919384-74919406 AAGAATTTGCAGCCTCCAGAAGG - Intergenic
1027091241 7:75303059-75303081 AAGAATTTGCAGCCTCCAGAAGG + Intergenic
1027094885 7:75331032-75331054 AAGAATTTGCAGCCTCCAGAAGG + Intergenic
1027324454 7:77036653-77036675 AAGAATTTGCAGCCTCCAGAAGG - Intergenic
1028764533 7:94537505-94537527 AAGATTTTGAAGCCTGTAGATGG + Exonic
1029394995 7:100301755-100301777 AAGAATTTGCAGCCTCCAGAAGG + Intergenic
1029452488 7:100648921-100648943 AGAGATTTGCAGACTGGGGATGG - Intronic
1030821229 7:114094541-114094563 AATTATTTTCAGTCTGTGGAGGG - Intronic
1032584657 7:133135059-133135081 TAGGAAGTGCAGCCTATGGAAGG - Intergenic
1034240857 7:149609697-149609719 AAGGATTTTCGGCCTGAGAATGG - Intergenic
1035221869 7:157410995-157411017 CAGGATGTGCCGCCTGTGGGTGG + Intronic
1036450269 8:8860108-8860130 AAGGATTTGCAGCCCTGAGAGGG - Intronic
1037678273 8:21071253-21071275 AAGAATGTGAAGCCTGTGGGTGG + Intergenic
1039165279 8:34672460-34672482 AATGATTTACATCCTTTGGATGG - Intergenic
1039768970 8:40663400-40663422 AAGGGTTTGAAGTCTGAGGAAGG - Intronic
1041003973 8:53481508-53481530 AAGGATGAGCAGCATGGGGATGG - Intergenic
1044100379 8:88128794-88128816 AAGTATTTATAGGCTGTGGAAGG + Intronic
1045826622 8:106405284-106405306 CTGGATTTGCACCTTGTGGATGG - Intronic
1048452323 8:134544212-134544234 AAGGATTTGCAGCCTGTGGAGGG - Intronic
1048491986 8:134902450-134902472 AAGGATTTGCAGCCTGGAAGAGG - Intergenic
1049416778 8:142499000-142499022 AAGGCCTAGCAGCCTGTGGTTGG - Intronic
1049448210 8:142641344-142641366 AAGGCTTTGCTGCCTGCAGAGGG - Intergenic
1052421501 9:28248485-28248507 AAGGATATGCAGATTGTTGACGG + Intronic
1053185483 9:36012792-36012814 GAGCATTTGCAGCTTCTGGAGGG - Intergenic
1053716134 9:40890982-40891004 AGGGCTTTGCAGCCTATGGTAGG + Intergenic
1053754767 9:41294280-41294302 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1054076384 9:60539295-60539317 AGGGCTTTGCAGCCTATGGTAGG - Intergenic
1054260289 9:62858583-62858605 AGAGATTGACAGCCTGTGGAGGG + Intergenic
1055559368 9:77507382-77507404 AAGGTTTTCCTGCCTTTGGAAGG - Intronic
1057323223 9:94033149-94033171 AAGGACGTGCAGGCTGGGGACGG - Intronic
1058222263 9:102316980-102317002 AAAGATTACCATCCTGTGGAGGG + Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058669023 9:107345080-107345102 AAGGCTTTGGAGCCTGTCTATGG - Intergenic
1059818626 9:117947000-117947022 AAGATTTTGCTACCTGTGGAGGG - Intergenic
1060027791 9:120187584-120187606 CAGGATTCCCAGCCTGGGGAAGG + Intergenic
1061917151 9:133761139-133761161 AAGGAGCTGCTGCCTCTGGATGG + Intergenic
1185757403 X:2662637-2662659 AAAAATTGGCAGCCTGTGGCAGG + Intergenic
1186707729 X:12159932-12159954 AAAGATTTGCAGCTTGTGACTGG + Intronic
1191893380 X:65967675-65967697 AAGGTTTTGTAGCCTGTATAAGG + Intergenic
1193853851 X:86573827-86573849 AAGTATTTGCAGCCTGAGTAGGG - Intronic
1194946227 X:100071275-100071297 AAGGATTTTCAGACGGGGGAAGG - Intergenic
1196300723 X:114047449-114047471 TAGGCTTTTCAGCCTGAGGATGG - Intergenic
1200908055 Y:8505779-8505801 ATGGATTAATAGCCTGTGGAAGG - Intergenic