ID: 1048456202

View in Genome Browser
Species Human (GRCh38)
Location 8:134580415-134580437
Sequence CTGTGCTTGTGCAGGTGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048456202_1048456207 29 Left 1048456202 8:134580415-134580437 CCAAGGCACCTGCACAAGCACAG 0: 1
1: 0
2: 1
3: 27
4: 282
Right 1048456207 8:134580467-134580489 ACATCCTCAAAGAGCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048456202 Original CRISPR CTGTGCTTGTGCAGGTGCCT TGG (reversed) Intronic
900030387 1:367088-367110 GTGTGTTTGTGCAGGTGCACTGG - Intergenic
900051039 1:596152-596174 GTGTGTTTGTGCAGGTGCACTGG - Intergenic
900125479 1:1067283-1067305 CTGTGCAGGTGCAGGTGCGGCGG - Intergenic
900125876 1:1068796-1068818 CTGTGCAGGTGCAGGTGCGGCGG + Intergenic
900267392 1:1765012-1765034 CTGTGCCTGTGCTGGCACCTGGG + Intronic
900464650 1:2819699-2819721 GTGTGTGTGTGCAGGTGCGTGGG - Intergenic
900752228 1:4405857-4405879 CTGTTCTTGTTAAGGTTCCTGGG - Intergenic
901528960 1:9841962-9841984 CAGTGCTTGTCCAGGAGCCCAGG - Intergenic
902843007 1:19087227-19087249 CTGTGAAAGGGCAGGTGCCTGGG - Intronic
903819629 1:26092092-26092114 CTGTGCATGTGTAGGGGCCAGGG + Intergenic
904296428 1:29522287-29522309 CTGTGCCTGTGAAGGGGGCTGGG + Intergenic
904743408 1:32695795-32695817 CTCTGCATGTGGAGGAGCCTGGG - Exonic
904794559 1:33049554-33049576 CTTTGCTTGTTCAGGTGGCTTGG - Intronic
904810114 1:33158088-33158110 GAGTGATTGTGCAGGTGCCCAGG + Intronic
905885194 1:41487997-41488019 CTGGGCTGCAGCAGGTGCCTGGG + Intergenic
906103430 1:43277523-43277545 CGGGGCATGTGCAGGTCCCTTGG - Intergenic
907012853 1:50978908-50978930 CTGTGCTTCTGCAGGTGCTGTGG - Intergenic
908254333 1:62290519-62290541 AAGTGCTTGTGCTGGTGCCCAGG + Intronic
908734623 1:67263142-67263164 CTGTGATTGTGCACCAGCCTGGG - Intergenic
909805453 1:79869134-79869156 CTGTTCTTTTGCAATTGCCTAGG - Intergenic
912547503 1:110461416-110461438 CTGTGCTTGGGCAGGGGCTGAGG + Intergenic
912884702 1:113458196-113458218 CGTTGCTTGTGCTGGTGGCTTGG + Intronic
914666909 1:149840165-149840187 CTGTGCTAGTGGAGGTGGCGCGG + Exonic
914668858 1:149853625-149853647 CTGTGCTAGTGGAGGTGGCGCGG - Exonic
915008539 1:152663407-152663429 CTGTGCTTTTGCATGTGACCAGG + Exonic
915489830 1:156244883-156244905 CTGTGCTGGGGCAGGGGCCACGG - Exonic
915624730 1:157107603-157107625 ATGTCCTTCTGCAGGTGCCAGGG + Intergenic
916108030 1:161444760-161444782 CGGAGGTTGTGCAGATGCCTGGG - Intergenic
916109616 1:161452140-161452162 CGGAGGTTGTGCAGATGCCTGGG - Intergenic
916111201 1:161459549-161459571 CGGAGGTTGTGCAGATGCCTGGG - Intergenic
916112789 1:161466931-161466953 CGGAGGTTGTGCAGATGCCTGGG - Intergenic
917563971 1:176192223-176192245 CTGTGTTTGGGCAGGAGCCTTGG - Intronic
917620937 1:176795075-176795097 CTGTGCTGCTGCAGGTGCAGGGG - Intronic
918042741 1:180923111-180923133 CTGGGCTTGTGAAGGTTTCTGGG - Intronic
921110813 1:212035198-212035220 CTGTGCTTTTGCTGGGGCGTGGG - Intronic
922151071 1:223004779-223004801 CAGTGCATGTGCCGGTGCCTTGG + Exonic
922567151 1:226608208-226608230 CTGTGCTGGAGCAGGTGGGTGGG - Exonic
1064003669 10:11683669-11683691 CTCTGCCTGGGCAGGTGGCTGGG - Intergenic
1064981821 10:21173643-21173665 CGGTGCGTGTGCGTGTGCCTTGG - Intronic
1065967355 10:30780813-30780835 TTGTGCTTGCACCGGTGCCTCGG - Intergenic
1066349802 10:34626874-34626896 CTGGGCTTATGCATGTGCCTAGG - Intronic
1067082767 10:43221015-43221037 CAGTGCTTCTGCAGGTGTCTTGG - Intronic
1067529946 10:47063099-47063121 GTGTGCTGGGGCAGGGGCCTGGG - Intergenic
1068780247 10:60912268-60912290 CTGTGCTTGTGCTGTAGCCTGGG - Intronic
1069555353 10:69394153-69394175 CTGGGCTTGGGCATGTGCCATGG + Intronic
1070326377 10:75392085-75392107 CTGTGCTGGTCCCTGTGCCTGGG - Intergenic
1071682105 10:87716661-87716683 CTGTGTTTGTGCCTTTGCCTGGG + Intronic
1072172161 10:92875040-92875062 CTGTGTTTGTGCACTTTCCTAGG + Intronic
1073217063 10:101842307-101842329 CTGTGCATGTGCATGTTCCTGGG - Intronic
1073467685 10:103703883-103703905 CTGTGTGTGTGTAGCTGCCTAGG + Intronic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1074713004 10:116193003-116193025 CTGTGTGTGTGGAGGGGCCTGGG - Intronic
1075335941 10:121608995-121609017 CTGTGCTTGGGCAAGCACCTGGG - Intergenic
1076540056 10:131208031-131208053 CTGTGGTTGGGCTGGTCCCTAGG - Intronic
1076686235 10:132199656-132199678 CTGGGGCTGTGCAGGTCCCTGGG + Intronic
1076901375 10:133340114-133340136 CTGTGCAGGGGCAGGTGCCCTGG + Intronic
1077049950 11:562094-562116 TTGTGCTTGTGCAGCGGCTTCGG + Exonic
1077169080 11:1158441-1158463 GTGTGCAAGGGCAGGTGCCTGGG - Intronic
1077266419 11:1653029-1653051 CTCTCCTTTGGCAGGTGCCTGGG + Intergenic
1078019111 11:7640708-7640730 CAGCTCTTGTGCAGGTGCCTGGG - Intronic
1078151857 11:8766339-8766361 ATGTGGATGTGCAGGCGCCTGGG - Intronic
1079099776 11:17533919-17533941 CGGGGCTTGTGCAGGGGCCTGGG - Intronic
1079123464 11:17701503-17701525 CTGTGCATGTGTAGGTGCAGGGG - Intergenic
1083897075 11:65625333-65625355 CTGTGCATGTGCCCGTGACTGGG + Intronic
1084105251 11:66976513-66976535 CTGGGCTTGGGTAGGGGCCTTGG + Exonic
1084478714 11:69404125-69404147 CTGGGCTTGTGGGGGGGCCTCGG - Intergenic
1084728536 11:71058560-71058582 CTGGGCTGGTGCTTGTGCCTCGG + Intronic
1085250649 11:75141430-75141452 CTGTGCATATGCAGGCGCCAGGG + Intronic
1086337541 11:85813771-85813793 CTGTGTTTGTGCCACTGCCTGGG - Intergenic
1087592515 11:100209089-100209111 CTGTGCTTCTGTAAGTGACTTGG - Intronic
1088314763 11:108496931-108496953 CTGTGCTTCTGCACATGCCATGG + Intronic
1089631467 11:119787157-119787179 CTGTGCTCGTGCAGGTGGGCAGG + Intergenic
1089691128 11:120187296-120187318 GTGTGTTTGTGCAGGGGCCAGGG + Intergenic
1090674736 11:128980657-128980679 CTGAGCTTGTGTTCGTGCCTGGG + Exonic
1090834062 11:130441027-130441049 TTTTGCGTGTGCATGTGCCTGGG + Intergenic
1091514375 12:1164032-1164054 CCCAGCTTCTGCAGGTGCCTTGG + Intronic
1091803228 12:3338284-3338306 CTGTGAGTGTGCAGGTGCCCAGG - Intergenic
1094302851 12:28985532-28985554 CTGTGCATGAGCAGGAGCATGGG - Intergenic
1094489839 12:30952914-30952936 GTGTGGGTGTGCAGGTGCCCAGG + Intronic
1095959656 12:47826309-47826331 CTGTGGTGCTGCAGGTTCCTGGG - Intronic
1096737917 12:53670495-53670517 CTGTGATTGGGCAGGTGACTGGG + Intronic
1098527868 12:71507429-71507451 CTGTGTCTGTGCATGTGTCTGGG + Intronic
1099238160 12:80107065-80107087 CTGGGCTTGCTCAGGTGTCTAGG + Intergenic
1099318335 12:81112496-81112518 CTGTGTTTGTGCTGGTTCCCTGG + Intronic
1101820689 12:108181834-108181856 CTGTGGTTGTGCTGAGGCCTGGG + Intronic
1103915399 12:124373283-124373305 CAGTGCGTGTGCAGGGGCCCGGG + Intronic
1103915408 12:124373327-124373349 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1103915419 12:124373372-124373394 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1103915521 12:124373762-124373784 CAGTGCGTGTGCAGGGGCCCTGG + Intronic
1103915532 12:124373807-124373829 CAGTGCGTGTGCAGGGGCCCTGG + Intronic
1103915555 12:124373894-124373916 CAGTGCGTGTGCAGGGGCCCCGG + Intronic
1105446454 13:20461847-20461869 CTGTGCTTGGGAAGATGGCTTGG - Intronic
1105484593 13:20814642-20814664 CTGTGCACGTGCTGCTGCCTTGG - Intronic
1106314282 13:28579410-28579432 CTGTTCTTCTCCCGGTGCCTTGG - Intergenic
1111576442 13:90160688-90160710 CTGTCCTTGTGCAAGTACCATGG - Intergenic
1112387959 13:98957919-98957941 CTGTGCCTGTGCAGGCAGCTGGG - Intronic
1113555268 13:111229036-111229058 CTGTGATGGTGGAGCTGCCTCGG + Intronic
1113619502 13:111703384-111703406 CAGTGCTAGTGCAGTGGCCTGGG + Intergenic
1113625031 13:111788645-111788667 CAGTGCTAGTGCAGTGGCCTGGG + Intergenic
1114783734 14:25570149-25570171 CTGTGGTTGAGCTGGTACCTAGG + Intergenic
1116821631 14:49633524-49633546 CTCTGCTCATTCAGGTGCCTCGG - Exonic
1116827486 14:49686854-49686876 CTGTGCTTTGGGAGATGCCTTGG - Intronic
1118177126 14:63451806-63451828 CTGTGCTTGTGCAGGGACAGGGG + Intronic
1119072837 14:71605706-71605728 CTGAACTTTTGCTGGTGCCTAGG + Intronic
1119886000 14:78142850-78142872 ATGCGCTTGTGCAGGAGTCTGGG + Intergenic
1121020472 14:90577323-90577345 GTGTGTTAGTGCAGCTGCCTCGG - Intronic
1121405459 14:93716871-93716893 GCCTGCTTGTGCAGGGGCCTGGG - Intergenic
1121518185 14:94567865-94567887 CTGTGGGTGTTCAGGTGCCCAGG - Intronic
1122847973 14:104511068-104511090 CTGTGCTTGTGCTGCCGGCTTGG + Intronic
1124195206 15:27619415-27619437 CTGTGCCTGTGCCGGGGGCTGGG - Intergenic
1125756856 15:42070529-42070551 CTGGGGTGGTGCAGGGGCCTTGG - Intronic
1125999415 15:44195140-44195162 GGGTGATGGTGCAGGTGCCTGGG - Exonic
1128188433 15:65665846-65665868 CTATGATTGTGCATGTGCTTCGG - Intronic
1132025566 15:98401873-98401895 CTGTGCTTGGGGAGGTGGCCAGG - Intergenic
1132304826 15:100803491-100803513 CCGTGCTTGTGCGGGTGACAGGG - Intergenic
1132339092 15:101066770-101066792 CTGTGCTCATGCTGCTGCCTGGG - Intronic
1132506746 16:313905-313927 CTGTGGTTGTGCTGAGGCCTGGG - Intronic
1136268225 16:29133064-29133086 CTGCGCTTCTGCAGGTGTCCTGG + Intergenic
1138181398 16:54942574-54942596 CTGGACTTGTGCATCTGCCTTGG - Intergenic
1138475162 16:57266328-57266350 CTGTGCCTGCGGAGCTGCCTCGG + Intronic
1139164903 16:64554462-64554484 CTGTGCTTGGCCAGGTGCGGTGG - Intergenic
1142071536 16:88093402-88093424 CTGCGCTTCTGCAGGTGTCCTGG + Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1144855326 17:18264304-18264326 CTGTGCTTGTGGCAGTCCCTGGG + Exonic
1146130758 17:30272859-30272881 TTGTACTTGTGCTGGGGCCTAGG + Exonic
1146501246 17:33366427-33366449 CAGTGCATGTGCAGGTACCAAGG - Intronic
1147057784 17:37847378-37847400 ATGTGCGTGTGCAAGAGCCTCGG + Intergenic
1147161297 17:38570871-38570893 CTGCGCTTGTGCCGGTCACTTGG + Intronic
1148138185 17:45309273-45309295 CTCGGATTCTGCAGGTGCCTGGG - Intronic
1149513588 17:57262734-57262756 TTGTGCAAGTGCTGGTGCCTGGG + Intronic
1150137296 17:62703053-62703075 CTGTCCTGGTGCTGGTTCCTGGG + Intronic
1150409863 17:64934381-64934403 CTGTGCCTGTGGAAGTCCCTTGG - Intergenic
1150565285 17:66333610-66333632 CTGTGCTTGTGAAGGGGTCTGGG + Intronic
1151325872 17:73379534-73379556 CTGTGCTTGTTCAGGTCTGTGGG + Exonic
1151360997 17:73588794-73588816 CTGTGCTTGTGCATTGGCCCTGG - Intronic
1151929049 17:77219296-77219318 CCGAGTCTGTGCAGGTGCCTGGG + Intergenic
1152239670 17:79154846-79154868 GTGCACCTGTGCAGGTGCCTGGG - Intronic
1152414925 17:80153316-80153338 ATGTACATGTGCAGGTCCCTGGG - Intergenic
1152574400 17:81133742-81133764 CTGTCCTTGGCCAGGGGCCTTGG + Intronic
1152949372 17:83219469-83219491 GTGTGTTTGTGCAGGTGCACTGG + Intergenic
1153457575 18:5296441-5296463 CCGTGCGTGTGCATGTGCGTGGG + Intronic
1154163857 18:11999562-11999584 CTATGCCTGTTCAGCTGCCTGGG + Intronic
1158448127 18:57538858-57538880 TCGTGCTTGGGCAGGTTCCTCGG - Intergenic
1159292526 18:66440503-66440525 TGGTGCCTGTGCTGGTGCCTGGG + Intergenic
1159870962 18:73759438-73759460 GTCTGCTTGTGCAGTTGTCTGGG - Intergenic
1160859871 19:1233248-1233270 CTGAGGTTCTGCAGGTGGCTGGG - Intronic
1160886617 19:1352725-1352747 CTGTGCTTTGGGAGGTGCTTTGG - Intergenic
1162860922 19:13505624-13505646 CTGGGGTCGTGCAGGAGCCTTGG - Intronic
1165428192 19:35756976-35756998 CTGTGCCTGTGCAGCCGTCTTGG - Exonic
1165744184 19:38221003-38221025 CTGTGGGTGTGTGGGTGCCTCGG - Intronic
1166999459 19:46737375-46737397 CTGTGCCTGGCCAGGGGCCTGGG + Intronic
1167496817 19:49824303-49824325 CTGTGAATGTCCAGGTCCCTGGG + Intronic
926075332 2:9938178-9938200 CCGTGTCAGTGCAGGTGCCTGGG - Intergenic
926358779 2:12065807-12065829 CTGTGCATGTGCATGAGCATGGG - Intergenic
927533981 2:23837431-23837453 CTGTGCTCTTGCGGGGGCCTGGG - Intronic
927846170 2:26473857-26473879 CTGGGCTGGGGCAGGAGCCTGGG + Intronic
928432555 2:31233143-31233165 CTCAGCATGTGCAGGGGCCTGGG - Intronic
931254025 2:60554791-60554813 CTGTGCTTTTGCAGTTGCTCTGG - Intergenic
931620916 2:64208531-64208553 CTGTGTTGTTGCAGGTGCATTGG + Intergenic
934495599 2:94794602-94794624 TTGTGCTTGGCCAGGTGCCGTGG - Intergenic
935446266 2:103159627-103159649 GTGTGCATGTGTATGTGCCTGGG + Intergenic
935569157 2:104641007-104641029 CTGTGATTGGGCATGGGCCTGGG + Intergenic
937297426 2:120818050-120818072 CTGTGCTTTTCCAGGGCCCTTGG + Intronic
937767574 2:125679872-125679894 CTGTTCTGGTGGAGGTGGCTGGG + Intergenic
937883446 2:126885075-126885097 CAGAGCTGCTGCAGGTGCCTGGG - Intergenic
938135149 2:128750658-128750680 CTCTGCCTGTGCACATGCCTGGG + Intergenic
939366653 2:141241798-141241820 CTATGCTGGTGCTGGTGACTAGG + Intronic
940499983 2:154481699-154481721 CTGTATTTGTGCAACTGCCTTGG - Intergenic
942061277 2:172230784-172230806 CAGTGCCGGTGCAGGTCCCTTGG + Intergenic
943822832 2:192348899-192348921 ATGTGCTTGGGCAGGTGCAGTGG - Intergenic
944330374 2:198458386-198458408 CTGTGCATCTGCAGGTGGCTGGG - Intronic
945137656 2:206645920-206645942 CTGTACTGGTGCTGATGCCTGGG - Intergenic
945996420 2:216440572-216440594 CTGTGTTTATGAAGGTGTCTTGG + Intronic
948139051 2:235659620-235659642 CTGTGCAGGTCCAGGTGCCGAGG + Intronic
948211023 2:236193259-236193281 CTGGGCAGGTGCACGTGCCTTGG + Intergenic
948437244 2:237962008-237962030 CTGGGCTGGTGCAGGGACCTGGG - Intergenic
948687344 2:239677530-239677552 CTGTGTGTGTGCAGGGGCCAGGG - Intergenic
1168909103 20:1431835-1431857 CTGTGATTATGCAGTTGCCCCGG + Intergenic
1169194560 20:3676182-3676204 CTGTGCTCAGGAAGGTGCCTTGG - Intronic
1169240309 20:3972362-3972384 CTGTCCTGGTGTAGGTGCCATGG - Intronic
1169895083 20:10496171-10496193 CAGTGCTTATGCATGTGTCTGGG + Intronic
1171457881 20:25282166-25282188 CCGTGCCTGTGGAGATGCCTGGG + Intronic
1173316747 20:41951363-41951385 CTGTGCTTGTCCAGGCTCATGGG + Intergenic
1175532686 20:59684982-59685004 CTTTGCTTCTGCAGGTCCCTTGG + Intronic
1175796687 20:61775659-61775681 CTGTGCCTGTGAGGGTGGCTTGG - Intronic
1176086084 20:63296184-63296206 CATTGCATGAGCAGGTGCCTTGG + Intronic
1176099687 20:63359259-63359281 CTTTGCTTCCGAAGGTGCCTGGG + Intronic
1177769725 21:25500890-25500912 CAGTTCTTGTGCAGTTGGCTGGG - Intergenic
1179405486 21:41122186-41122208 CTGTGCTCATGAAGGTGCCCCGG + Intergenic
1181669733 22:24420499-24420521 AGGTCCCTGTGCAGGTGCCTGGG - Intronic
1181719596 22:24763717-24763739 CTGTGCTTGTGGGGATGCCTGGG - Intronic
1183404340 22:37623103-37623125 ATGAGCTTGTGCAGAGGCCTGGG + Intronic
1183759660 22:39804729-39804751 CTGTGCTTGGGGAAGGGCCTTGG - Intronic
1185080153 22:48705222-48705244 CTGTGGGTGTGAAGGTGCCGGGG + Intronic
949706246 3:6820730-6820752 CTGTGCTTGTGTGTGTGTCTTGG - Intronic
951221720 3:20075747-20075769 CTGAACATGTGGAGGTGCCTGGG - Intronic
952814656 3:37436673-37436695 CTGTCCCTGTGCATCTGCCTGGG + Intergenic
952857560 3:37784813-37784835 CTGTGTTTATGTGGGTGCCTGGG + Intronic
953603162 3:44387549-44387571 CAGTGCCTGTGCTGGTGCATGGG + Intronic
953617355 3:44503145-44503167 CAGTGTGTGTGGAGGTGCCTGGG - Intronic
953625545 3:44567801-44567823 CAGTGTGTGTGGAGGTGCCTGGG + Intronic
954704713 3:52473276-52473298 GTGTGCTTGGGCAGGTGGCTTGG + Intronic
955065059 3:55526794-55526816 CTGTGCTTGTGCTGCTGCTGGGG + Intronic
955525087 3:59811872-59811894 CTGTGATTGTGAAGGTGACAAGG + Intronic
957600330 3:82325712-82325734 ATGTGATTGTGAAGGTGCCCAGG - Intergenic
960936931 3:122910192-122910214 CTGTGTTTGTTCAGGGGGCTTGG + Exonic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961665286 3:128490355-128490377 GAGTGCTTGAGCAGGGGCCTCGG + Intronic
961703017 3:128761516-128761538 TTGGGCTGGTGCAGGTGCTTGGG + Intronic
961809809 3:129515248-129515270 CGCTGCCTGTGCAGGTGTCTTGG + Intronic
962260674 3:133901570-133901592 CTGTGCTTGTTGATGTGTCTGGG + Intergenic
962352533 3:134666303-134666325 ATGTGCAAATGCAGGTGCCTGGG + Intronic
963778177 3:149461359-149461381 TTGTTCTTGTGAAGATGCCTGGG - Intergenic
964410084 3:156388973-156388995 CTGTGATGGTGCAGGTGTTTTGG + Intronic
967257471 3:187608719-187608741 CTGTTCTGGTGCAGGTGGCAGGG + Intergenic
968599888 4:1503829-1503851 CTGCGCTTCTGCAGGAGCCCAGG + Intergenic
968620005 4:1599785-1599807 GAGTGCCTGTGCAGGTGTCTGGG - Intergenic
968818266 4:2832833-2832855 CTGTCCTTGTGCAGGTGGTCTGG + Intronic
968913490 4:3487186-3487208 CTGTGCCTCTGCAGGTGTGTGGG + Intronic
969146184 4:5125970-5125992 CTGTGATTGTCCAGTTGCCCTGG + Intronic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
981599982 4:146476499-146476521 GTGTGCATGTGCATGTGTCTTGG + Intronic
982435219 4:155377019-155377041 GTGTGCATGTGCTGTTGCCTAGG + Intergenic
983311608 4:166070591-166070613 CTGTCCTTGAGCAAGTCCCTAGG - Intronic
985066265 4:186125403-186125425 CTGTGTTTGTGGGGCTGCCTAGG - Intronic
985802341 5:2012994-2013016 CTCTGCTTGTCCAGGTGACCGGG - Intergenic
985936487 5:3101538-3101560 CCATGCTTGTGCAGGTACCAAGG + Intergenic
986106697 5:4666612-4666634 CAGAGCAAGTGCAGGTGCCTAGG - Intergenic
986125161 5:4877730-4877752 CTGTGCATGTGCAGGTTCCAGGG + Intergenic
986803631 5:11286858-11286880 CTGTTCTTGTGCATGTGTCCTGG - Intronic
987262800 5:16220556-16220578 TTGTGCTTTCTCAGGTGCCTAGG - Intergenic
989074863 5:37553578-37553600 GTGTGCTTGTGCATGTGCTGAGG + Intronic
989411434 5:41123722-41123744 CTCAGCTTCTGCAGGTGCTTGGG + Intergenic
990632488 5:57685509-57685531 GTGTGCATGTGCATGTGCATAGG + Intergenic
992035403 5:72769789-72769811 CTCTGCTTCTGGAGGTGGCTTGG - Intergenic
993325300 5:86526948-86526970 CAGAGCTTCTGCAGGTGCCTTGG + Intergenic
995218151 5:109618660-109618682 CTGTGGTTGGGAAGGTGCATGGG - Intergenic
996134344 5:119820578-119820600 CAGTGCATGAGCAGGTGCATTGG + Intergenic
997155234 5:131549343-131549365 CTGTGTTTGGGTGGGTGCCTAGG - Intronic
997359884 5:133288353-133288375 CTGTGCTGCTGAGGGTGCCTGGG - Intronic
997582061 5:135024408-135024430 CGTTGCTTTTGCAGGTTCCTGGG - Intergenic
1000830776 5:166098519-166098541 CCTGGCTTGTCCAGGTGCCTTGG - Intergenic
1001382277 5:171312439-171312461 CTGGGCCTGGGCAGATGCCTAGG + Intergenic
1001576611 5:172768854-172768876 CGGTGGTGGTGGAGGTGCCTCGG + Exonic
1002096368 5:176833587-176833609 CTGGGGTCCTGCAGGTGCCTAGG - Intronic
1002743602 5:181453284-181453306 GTGTGTTTGTGCAGGTGCACTGG + Intergenic
1003640175 6:7869466-7869488 CAGTGCATGTGCCGCTGCCTGGG + Intronic
1004985763 6:21080430-21080452 GTCTCCTTGTGCAGGTCCCTGGG - Intronic
1005157056 6:22819229-22819251 CTGTGGTTGAGCTGGTACCTAGG + Intergenic
1006365574 6:33613250-33613272 CTGTGACTGTGAAGGTGCCCCGG + Intergenic
1013233660 6:108177513-108177535 TTGTGCGTGTGCATGTGCCCAGG - Intronic
1013798559 6:113912460-113912482 CTGTGCTTCTGGGAGTGCCTGGG - Intergenic
1016962980 6:149691246-149691268 CTCTGCATGTGCATGTGTCTGGG - Intronic
1017769575 6:157634749-157634771 CTGTGCGTGTGCAGGAGGCCTGG + Intronic
1017982813 6:159417092-159417114 CTGTGGTTGTGCATGTGCGCAGG - Intergenic
1018992868 6:168687253-168687275 CTTTGCTTGTGCAGGTGCCAGGG - Intergenic
1019248461 6:170726513-170726535 GTGTGTTTGTGCAGGTGCACTGG + Intergenic
1019570450 7:1709083-1709105 CTGTGCAGGTGCAGCTGCCTTGG + Exonic
1019705722 7:2496329-2496351 CTGTGTTTGTGCAGGAGCAGAGG - Intergenic
1020535298 7:9389201-9389223 CTGTGCTTTAGCAGGAGCCCTGG - Intergenic
1021286251 7:18784547-18784569 CTGTGCTTCTGCAAATGTCTGGG - Intronic
1023157575 7:37266079-37266101 CTGTCCTTGGGCAGCAGCCTGGG + Intronic
1025082463 7:55995596-55995618 CTGTGCTTATTCACATGCCTGGG - Intronic
1026204414 7:68244132-68244154 GTGTGTATGTGCAGGTGCATGGG - Intergenic
1026332383 7:69363993-69364015 CTGTGCTTGGCCAGGTGCCGTGG + Intergenic
1027174023 7:75892031-75892053 CTGTCCTTGTGCAGATGTCCAGG - Intergenic
1029508181 7:100975541-100975563 CTCTGCTTGAGCAGGTGCTCTGG + Intronic
1030047814 7:105513072-105513094 CTGTGGTGTTGCAGGTTCCTGGG + Intronic
1031098497 7:117448995-117449017 CTGTGATTGAGCTGTTGCCTAGG - Intergenic
1032991052 7:137395484-137395506 CTGTGCTTATGGAAGTGCCTGGG - Intronic
1033656124 7:143375884-143375906 CTGTGCTGCTGTTGGTGCCTTGG + Intergenic
1034462865 7:151207937-151207959 CTGTGCGTCTGCTGCTGCCTGGG - Exonic
1035063922 7:156091784-156091806 CGATGCTTGGGCAGGTGCCGGGG - Intergenic
1035499586 8:80823-80845 GTGTGTTTGTGCAGGTGCACTGG - Intergenic
1035856245 8:2979469-2979491 ATGTGCTTTTGCAGGTGCAGAGG + Intronic
1036031606 8:4980222-4980244 CTGTGCTTATCCAGCTGCCTGGG + Intronic
1037790643 8:21937477-21937499 CTGTGCTTGTCTAGTTTCCTAGG + Intronic
1045552598 8:103185974-103185996 CTCTGCTTGTTCTGGTGTCTTGG + Intronic
1047959076 8:129997753-129997775 CTGTGGATTTGCAGGTTCCTTGG + Intronic
1048161923 8:132029224-132029246 CTGTGCTTGAGGGGGTTCCTAGG - Intronic
1048209625 8:132443957-132443979 CTGTGCTTGTCCAAGGGGCTTGG - Intronic
1048456202 8:134580415-134580437 CTGTGCTTGTGCAGGTGCCTTGG - Intronic
1048990986 8:139759985-139760007 GTGTGCTGGTGCAGGGGCCTGGG - Intronic
1049617814 8:143583534-143583556 CTGGACTTGGTCAGGTGCCTGGG + Intronic
1051560555 9:18436345-18436367 ATGTGCTTGAGGAGGTGCATGGG - Intergenic
1052078755 9:24177407-24177429 CTTTGCTTGTGCTTGTGCCTAGG + Intergenic
1053280932 9:36819523-36819545 CTATGCCGGTGGAGGTGCCTGGG + Intergenic
1053661529 9:40285779-40285801 TTGTGCTTGGCCAGGTGCCGTGG + Intronic
1053897528 9:42758199-42758221 CTGTGCCTGGGCACTTGCCTAGG - Intergenic
1053911903 9:42915122-42915144 TTGTGCTTGGCCAGGTGCCGTGG + Intergenic
1054373650 9:64431996-64432018 TTGTGCTTGGCCAGGTGCCGTGG + Intergenic
1054523080 9:66090505-66090527 TTGTGCTTGGCCAGGTGCCGTGG - Intergenic
1056117911 9:83459539-83459561 CTGTGCATGTGCACAGGCCTAGG - Intronic
1056845238 9:90031866-90031888 CTATGCATGGGCAGGTGCCTCGG - Intergenic
1056845250 9:90031905-90031927 CTATGCATGGGCAGGTGCCTCGG - Intergenic
1059932940 9:119279347-119279369 CCGTGCGTGGGCAGGTGCCCTGG - Intronic
1060690556 9:125654551-125654573 CTGTACTTAGGCATGTGCCTTGG - Intronic
1062010322 9:134263592-134263614 CTGAGCTTCTGAAGGTCCCTGGG - Intergenic
1062684015 9:137800683-137800705 CTGCGCTTGTGGAGCTACCTGGG + Intronic
1203609420 Un_KI270748v1:83777-83799 GTGTGTTTGTGCAGGTGCACTGG + Intergenic
1185761571 X:2692738-2692760 CCGTTCATCTGCAGGTGCCTGGG - Intronic
1187490136 X:19743627-19743649 CTGACCTTATGCAGGTGTCTGGG + Intronic
1192892487 X:75406053-75406075 ATGTGTTTGTGCAGGTTCCAGGG - Intronic
1194700243 X:97105004-97105026 CTGTGCTTGTCCAGCTACTTGGG + Intronic
1196737144 X:118989905-118989927 CTGTGCTTGACCTGATGCCTTGG - Intronic
1197556700 X:127964363-127964385 CTGTTCTTGTGGAGGTGGCAGGG + Intergenic
1200014383 X:153147456-153147478 CTGTGCATGTGCTGGAGGCTGGG + Intergenic
1200025219 X:153252498-153252520 CTGTGCATGTGCTGGAGGCTGGG - Intergenic
1201765676 Y:17571588-17571610 GTGTGCGTGTGCACGTGCATAGG - Intergenic
1201835876 Y:18334401-18334423 GTGTGCGTGTGCACGTGCATAGG + Intergenic