ID: 1048456932

View in Genome Browser
Species Human (GRCh38)
Location 8:134586907-134586929
Sequence CCTCATTGGTAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048456924_1048456932 15 Left 1048456924 8:134586869-134586891 CCTGGGGCAAATTACTTCACCTC 0: 1
1: 13
2: 135
3: 833
4: 2839
Right 1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG No data
1048456925_1048456932 -4 Left 1048456925 8:134586888-134586910 CCTCTCTAAGCCTCATTTTCCTC 0: 4
1: 70
2: 826
3: 3230
4: 8082
Right 1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048456932 Original CRISPR CCTCATTGGTAAAATGGGGA TGG Intronic
No off target data available for this crispr