ID: 1048457056

View in Genome Browser
Species Human (GRCh38)
Location 8:134587741-134587763
Sequence ATGAGGGAATGGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1588
Summary {0: 1, 1: 1, 2: 25, 3: 134, 4: 1427}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048457056_1048457065 27 Left 1048457056 8:134587741-134587763 CCTTCTTCTCTCCATTCCCTCAT 0: 1
1: 1
2: 25
3: 134
4: 1427
Right 1048457065 8:134587791-134587813 TTCCTTCTCCATAGCCTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048457056 Original CRISPR ATGAGGGAATGGAGAGAAGA AGG (reversed) Intronic
900204828 1:1427391-1427413 TGGAGGGAAGGGGGAGAAGAGGG - Intronic
900433286 1:2612821-2612843 AGGGTGGGATGGAGAGAAGAGGG + Intronic
900993456 1:6108236-6108258 ATGGAGGGATGGAGAGATGACGG + Intronic
901401277 1:9016666-9016688 AGGAAGGAAAGGAGAGAGGAAGG + Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
901661204 1:10798997-10799019 GAGAAGGAATGGAGAGAGGATGG - Intergenic
901734344 1:11302920-11302942 ATCAGGGAAAGATGAGAAGAGGG + Intergenic
901751783 1:11414404-11414426 ATGAGGGATTGGAGGGCAGAGGG + Intergenic
901905579 1:12406693-12406715 TTGAGAGAATGGAGAGAATGGGG - Intronic
902277590 1:15350652-15350674 ATGAGGGCATGGAGAGGGCAAGG - Intronic
902364078 1:15959482-15959504 AGGAGGGAAGGGAAGGAAGAGGG + Intronic
902502713 1:16921728-16921750 AGGAGGGAGGAGAGAGAAGAGGG - Intronic
902649752 1:17829411-17829433 AGGAGGGCCTGGAGAGGAGATGG + Intergenic
902701527 1:18175621-18175643 ATAAGGGACTGGACAGAGGAAGG - Intronic
902822993 1:18954928-18954950 CTCAGGGAGTGGGGAGAAGAGGG + Intronic
903215400 1:21840982-21841004 ATGAGTGGATGGAGAGAGGAAGG - Intronic
903331550 1:22599588-22599610 AGGAGGGAGTGGAGAGAGGGAGG + Intronic
903331695 1:22600015-22600037 AGGAGGGAAGGGAGAGAAGGAGG + Intronic
904447993 1:30590032-30590054 ATTAGGTTATGGAGAGATGAAGG - Intergenic
904754755 1:32762046-32762068 ATGAGGAAATGGAAACCAGAGGG - Intronic
904881829 1:33705394-33705416 TTGAGGGAATGGGGAGATAATGG - Intronic
904883436 1:33717709-33717731 AAGAGGGCTAGGAGAGAAGAGGG + Intronic
904942588 1:34175838-34175860 GTGAGGCACTGGGGAGAAGAGGG - Intronic
905281071 1:36849793-36849815 GTTGGGGAATAGAGAGAAGATGG + Intronic
905379744 1:37553331-37553353 GTGAGAGATTGGAGAGAAGAGGG - Intronic
905467597 1:38167048-38167070 AGGTGGGAATGGAGTGAGGAGGG + Intergenic
905483447 1:38277416-38277438 ATGAGTGAATGGATAAACGATGG - Intergenic
905507099 1:38488761-38488783 ATGAGGACATGGTGAGAACATGG - Intergenic
906001623 1:42431268-42431290 AGGAAGGAAGGAAGAGAAGAAGG - Intronic
906113364 1:43339006-43339028 ATGGGGATATGGAGAGAAAAAGG + Intronic
906236091 1:44211759-44211781 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
906656036 1:47549020-47549042 AGGAGGGAAAGTAGAGAAGGTGG - Intergenic
906666599 1:47626515-47626537 AAGAGGCAAGAGAGAGAAGATGG - Intergenic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
907676425 1:56521742-56521764 AAGAGGGAAGGAAGAGAAAAGGG - Intronic
907709307 1:56863874-56863896 AGGAAGGAAGGGAGAGAAGGAGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907816385 1:57922080-57922102 ATGAGGGAATAAAGAGAAATGGG - Intronic
907972153 1:59393584-59393606 AAGAGAGAAGGGAGAGAGGAGGG - Intronic
908162354 1:61422795-61422817 ATGAGGGAGTGGGGTGGAGAGGG - Intronic
908259298 1:62327336-62327358 GGGAGAGAACGGAGAGAAGAAGG - Intergenic
908340832 1:63177488-63177510 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
908843429 1:68300795-68300817 AGGAAGGAATGGAGGAAAGAAGG - Intergenic
908997993 1:70181765-70181787 TTGAGTGAATGAAGAGTAGAGGG - Intronic
909022201 1:70444586-70444608 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
909089111 1:71204002-71204024 AGGAAGGAATAGAGAAAAGAAGG + Intergenic
909094831 1:71273635-71273657 TGGAGGGAATGGTGAGAAAAAGG + Intergenic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909692101 1:78420842-78420864 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
910118060 1:83754579-83754601 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
910232216 1:84997926-84997948 ATGAGAGAGTGAAGAAAAGAAGG - Intergenic
910341290 1:86190993-86191015 AAAAGGGAATGAAGAGGAGAAGG - Intergenic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910681194 1:89866807-89866829 AGGAGGGAATAGAGAGAGCAGGG + Intronic
910825965 1:91407395-91407417 ATTAGGGAAAGGGGAAAAGAAGG - Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
912160983 1:106984971-106984993 ATGAGGGTGAGGAGAGAGGAGGG - Intergenic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912718174 1:111997133-111997155 AGGAGGAAATGGAGAGAAATGGG - Intergenic
912753032 1:112301192-112301214 ATGAGGTAATGGATATGAGAGGG - Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913059308 1:115190253-115190275 ATGAGGGAATGCAGAAAGGCAGG - Intergenic
913432014 1:118805635-118805657 ATCAAGGAATGGAGTGAAGAAGG - Intergenic
913461806 1:119094822-119094844 AGGAGGAAATGGAGAGATGTAGG - Intronic
913466534 1:119148791-119148813 AGGAGGGAAGGAAAAGAAGAGGG + Intergenic
913491615 1:119385107-119385129 ATGGAGGAAAGGAGAAAAGAGGG - Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
913556453 1:119971972-119971994 ATGAGGGAAATGAGGGAGGAAGG + Intronic
913594052 1:120356382-120356404 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
913940384 1:125098253-125098275 ATGAGGGAAGGAAGGGAGGATGG - Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914086016 1:144455262-144455284 AGTAGGGAAGGGAGAGAAGTAGG + Intronic
914093204 1:144522608-144522630 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914305320 1:146411280-146411302 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
914362174 1:146944806-146944828 AGTAGGGAAGGGAGAGAAGTAGG - Intronic
914489451 1:148142147-148142169 AGTAGGGAAGGGAGAGAAGTAGG + Intronic
914589816 1:149097167-149097189 AGTAGGGAAGGGAGAGAAGTAGG + Intronic
914596737 1:149161532-149161554 ATGAGGGAATGGAGAGCAGGTGG - Intergenic
914783523 1:150807433-150807455 AGGAGGGAAGGGAGAGAAAAAGG - Intronic
914841891 1:151255187-151255209 ACGAGGGAATGGGGAGAGGAAGG - Intronic
915684078 1:157613627-157613649 ATGAGGGAATAAAGAGAAGCTGG + Intergenic
916017943 1:160766900-160766922 ATGAGGACAGGGAGAGATGAAGG + Intergenic
916296320 1:163224180-163224202 AGGAGGGCATGGAAAGAGGATGG - Intronic
916570789 1:166025497-166025519 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
916741267 1:167649173-167649195 AAGAGGGAATGGATAGTTGAAGG + Intronic
917021170 1:170589507-170589529 ATTAGGAAATGGAGAAATGAGGG + Intergenic
917036069 1:170748187-170748209 ATGAGGGAAGGGAGAGTAGGAGG - Intergenic
917072585 1:171168783-171168805 ATTAGGGAAGGGTGAGATGATGG - Intergenic
917152772 1:171962598-171962620 ATGAGGTCATGGAATGAAGATGG - Intronic
917165934 1:172113275-172113297 ATGAGGGAATCCATAGAACAGGG - Intronic
917243312 1:172973122-172973144 AAGATGGGATGGAGAGATGATGG - Intergenic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
917572396 1:176281859-176281881 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
917633473 1:176913212-176913234 AATAGGTAATGGAGAGAACATGG - Intronic
917665297 1:177220204-177220226 ATGGGGGAGTGGAGAGCAGGAGG + Intronic
917697694 1:177543865-177543887 ATAAGGAATTGGATAGAAGATGG - Intergenic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918116062 1:181498824-181498846 AGAAGGGACTAGAGAGAAGATGG - Intronic
918881981 1:190136512-190136534 AAGAGGGAAGGCAGGGAAGAAGG - Intronic
918957754 1:191232286-191232308 ATGAGAGAGGGAAGAGAAGAGGG + Intergenic
919827874 1:201516728-201516750 AGGAAGGAAAGGAGAGAGGAAGG + Intergenic
920116283 1:203624131-203624153 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
920186401 1:204161963-204161985 ATGAGGGAAAGGAGACAGGGAGG + Intronic
920293296 1:204939526-204939548 AGGAGGGAAAGTAGAGGAGAGGG - Intronic
920388803 1:205586144-205586166 ATATGGGAATGGAGAGGAGCCGG - Exonic
920818239 1:209355579-209355601 TCCAGGGAATGAAGAGAAGAGGG + Intergenic
921217855 1:212951938-212951960 AGGAAGGAATGGGGAGAGGAAGG - Intronic
921494033 1:215814507-215814529 ATGAAAGATTGGAGAGAAGTAGG + Intronic
921685995 1:218089789-218089811 ATGGTGGAGTGGAGAGAGGAGGG - Intergenic
921947139 1:220894075-220894097 GTTAGGGAATGGAGTAAAGAGGG - Intergenic
922008621 1:221557787-221557809 ATGACAGAAAGGAGTGAAGACGG + Intergenic
922134764 1:222814275-222814297 AGAAGGGCATGCAGAGAAGAAGG - Intergenic
922366589 1:224870872-224870894 ATGGGGGAATAAAGAGAAGTTGG + Intergenic
922457441 1:225786708-225786730 ATGAGGAAATTGAGACCAGAAGG - Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922664398 1:227456270-227456292 AGAAGGGACTAGAGAGAAGATGG - Intergenic
923124806 1:231025744-231025766 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
923232857 1:232004984-232005006 AGGAAGGAAAGAAGAGAAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923388893 1:233493897-233493919 ATGAGGAACTAGAAAGAAGATGG - Intergenic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923512866 1:234667729-234667751 CTGATGGAAAGAAGAGAAGAGGG - Intergenic
923877575 1:238065923-238065945 ATGAGAGAATGGAGGGTAGTTGG - Intergenic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
924255543 1:242179274-242179296 ATGAGGGCAAGGGGAGCAGACGG + Intronic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924297475 1:242603023-242603045 AAGAGGGAAAGAAGAGAAGAAGG - Intergenic
924298618 1:242614140-242614162 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
924422439 1:243922288-243922310 ATGGGGGAATGAGTAGAAGAAGG + Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
924476636 1:244387778-244387800 ATGGGGGAGTGAAGAGAAGTAGG + Intronic
924589031 1:245385907-245385929 ATGTGGGAAAAGAGAGAGGATGG + Intronic
924634323 1:245771007-245771029 ATGAGAGAAAGGAGAGAATGGGG + Intronic
924709161 1:246519640-246519662 CTAGGGGAATGGGGAGAAGAAGG + Intergenic
1062838936 10:654682-654704 ATGAGGACAGGGAGATAAGAGGG - Intronic
1062989259 10:1800176-1800198 GTGAGGGAAGGGTGAGGAGACGG + Intergenic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063090075 10:2857078-2857100 GGGAGGGAAAGGAGAGAGGAGGG + Intergenic
1063180689 10:3596352-3596374 AGGAGGGAAGGGAGAGAAGAGGG + Intergenic
1063231296 10:4067897-4067919 ATGAGGGAAGCAAGACAAGAGGG - Intergenic
1063260543 10:4384607-4384629 AAGAGGGAAAGAAGAAAAGAAGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063877714 10:10497551-10497573 AAGAGGAAAGGGAGAGATGAAGG + Intergenic
1064000658 10:11661477-11661499 GAGAGAGAATGGAGAGGAGAGGG - Intergenic
1064210500 10:13357187-13357209 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1064499639 10:15956421-15956443 AAGAGGCAATGGGGAGATGAAGG - Intergenic
1064895358 10:20229187-20229209 ATGAGGGAAGGGAGACAGGAGGG + Intronic
1065198100 10:23286476-23286498 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1065713721 10:28543725-28543747 ATTAGGAAATGCAGAGAAAAGGG + Intronic
1065947921 10:30624274-30624296 AGCAGGGAAGGGACAGAAGAAGG + Intronic
1065973875 10:30825799-30825821 ATGATGGAGTGGAGACAATATGG + Intronic
1066190008 10:33047479-33047501 GTTATGGAAGGGAGAGAAGAGGG + Intergenic
1066305516 10:34136714-34136736 AAGATGGAAGGGAAAGAAGAGGG - Intronic
1066423047 10:35279477-35279499 ATGAGGGAAAACAGAGCAGATGG - Intronic
1066556597 10:36621218-36621240 ATGAAGAAATGAAGGGAAGAAGG - Intergenic
1066950243 10:42110747-42110769 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
1067068474 10:43116550-43116572 ATGAGGGAAGGGGGAGAAGAGGG - Intronic
1067259215 10:44672988-44673010 CTCAGGGAATGGCGAGATGATGG + Intergenic
1067399717 10:45959954-45959976 GTGAGGAACTGGAGAAAAGATGG - Intergenic
1067743540 10:48914914-48914936 ATGAGAGAATGGGCAGGAGATGG - Intronic
1067868045 10:49929248-49929270 GTGAGGAACTGGAGAAAAGATGG - Intronic
1068059703 10:52051796-52051818 ATGAGGAAAAGAAGAGAAGTTGG + Intronic
1068133966 10:52932069-52932091 AGGTGGGAATGGAGAAAAAAGGG + Intergenic
1068670186 10:59714626-59714648 ATCATGTAATGAAGAGAAGAAGG - Intronic
1069067947 10:63964252-63964274 AGGAGCTAATTGAGAGAAGAGGG - Intergenic
1069273847 10:66565388-66565410 ATGTGGGAACTGAGAGATGAGGG + Intronic
1069436956 10:68393009-68393031 TTGAGGGGATAGAGAGAAAATGG - Intronic
1069567185 10:69471575-69471597 AAGAGGGGAGGGAGAGAAGGTGG - Intronic
1069678295 10:70265385-70265407 ATGAGAGAGTAGAGAGTAGATGG + Intronic
1069830449 10:71279433-71279455 ATGAGGAACTGGATAGAAGCCGG + Intronic
1069843142 10:71352514-71352536 AGGAAGGAAAGGAGACAAGAAGG - Intronic
1070029179 10:72660736-72660758 AAGAATGAAAGGAGAGAAGATGG + Intergenic
1070339221 10:75481281-75481303 ATGAGCAACTGGAGAGTAGAGGG + Intronic
1070481245 10:76884751-76884773 AAGAAGGAAGGAAGAGAAGAAGG + Intronic
1070574958 10:77670738-77670760 ATGAGAGAAGGGAGAGAGAAAGG + Intergenic
1070647715 10:78212957-78212979 ATGAGGAAGAGGAAAGAAGAGGG - Intergenic
1071081300 10:81815208-81815230 ATTAGGGAAGGGAGTGGAGAAGG + Intergenic
1071141182 10:82510969-82510991 ATGAGTGAATGGATATAAGTAGG + Intronic
1071149122 10:82612292-82612314 ATGAGGGAAGGAAGGCAAGATGG - Intronic
1071161322 10:82749093-82749115 TTGAGGGCTTGGAGAGAGGAGGG + Intronic
1071355606 10:84790459-84790481 ATGAGGGAAAGGAAAGAACTAGG + Intergenic
1071377055 10:85017305-85017327 ATTGGGGAATGAAGAGAAGATGG - Intergenic
1071477724 10:86039124-86039146 ATGAGGGAAGGAAGGGAAGTGGG - Intronic
1071480023 10:86058111-86058133 AGGAAGGAAGGGAGAGAGGAAGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072910762 10:99498837-99498859 CGAAGGGAATGGAGAGGAGAAGG - Intergenic
1073055327 10:100696510-100696532 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1073096422 10:100983077-100983099 ATGAGAGCATGGAGAGAGAATGG + Intronic
1073125743 10:101147747-101147769 TTGAGGGAGTGAAGTGAAGATGG - Intergenic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1074293551 10:112160259-112160281 AAGAGAGGAAGGAGAGAAGAGGG - Intronic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074580540 10:114714909-114714931 ATGGGACAAGGGAGAGAAGAAGG - Intergenic
1075447807 10:122526016-122526038 AGGAAGGAATAGAGAGAGGATGG + Intergenic
1075590555 10:123688190-123688212 ATGAGGCAGCGGTGAGAAGAAGG + Exonic
1075963005 10:126585438-126585460 AAGAAGGAAAGGAGGGAAGAAGG + Intronic
1076034080 10:127184456-127184478 ATGGGGGAATGGAGAGCTGAGGG - Intronic
1076373479 10:129968928-129968950 AGGAGGCAATGCAGAGAACAGGG - Intergenic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076811187 10:132887302-132887324 AGGAGAGAGGGGAGAGAAGAGGG - Intronic
1076811230 10:132887537-132887559 AGAAGGGAGAGGAGAGAAGAGGG - Intronic
1076811238 10:132887578-132887600 AGAAGGGAGAGGAGAGAAGAGGG - Intronic
1076811265 10:132887754-132887776 AGAAGGGAGAGGAGAGAAGAGGG - Intronic
1076811277 10:132887812-132887834 AGAAGGGAGAGGAGAGAAGAGGG - Intronic
1076867360 10:133174648-133174670 ATGGGTGAATGGACAGATGATGG + Intronic
1077287760 11:1775373-1775395 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287770 11:1775406-1775428 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287776 11:1775428-1775450 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287803 11:1775506-1775528 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287813 11:1775539-1775561 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287831 11:1775595-1775617 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287841 11:1775628-1775650 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287847 11:1775650-1775672 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287862 11:1775695-1775717 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287928 11:1775874-1775896 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287942 11:1775918-1775940 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077287969 11:1775996-1776018 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077288002 11:1776096-1776118 GAGAGGGGATGGAGAGGAGATGG + Intergenic
1077354037 11:2106538-2106560 AAGAAGGAAGGAAGAGAAGAAGG + Intergenic
1077923199 11:6656148-6656170 AATAGGGGATGGAAAGAAGATGG - Intergenic
1078067087 11:8085651-8085673 ATGAGGGCAGGAAGAGGAGAAGG + Intronic
1078357019 11:10640038-10640060 ATGAAGGAATGGGGAGAGAAGGG + Intronic
1078457211 11:11484669-11484691 ATGATGGAATGGACACTAGATGG + Intronic
1078535555 11:12170703-12170725 AGGAGGCAATGGGGAGGAGATGG - Intronic
1078625428 11:12951528-12951550 ATGAGGAGATGGCGAGAAGGAGG + Intergenic
1078734862 11:14010501-14010523 ATGAGGGATTGGGGAGAATCAGG + Intronic
1078923647 11:15854461-15854483 AGGAGGGAAGGAAGGGAAGAAGG + Intergenic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079312581 11:19379482-19379504 ACTAGGAAATGGACAGAAGAAGG - Intronic
1079346030 11:19653061-19653083 AGAAGGGAATGGAGAAAGGATGG - Intronic
1079511050 11:21210933-21210955 ATGATGGAAGGCAGAAAAGAAGG - Intronic
1079956051 11:26866067-26866089 AGGAAGGAAGGGAGGGAAGACGG + Intergenic
1079961184 11:26925931-26925953 ATGAAGACATGGAGAAAAGAAGG - Intergenic
1079989969 11:27235987-27236009 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1080036452 11:27717676-27717698 AGAAGGTGATGGAGAGAAGAAGG - Intronic
1080139785 11:28902669-28902691 AAGAGGGAAGGCAGAGAAGTTGG + Intergenic
1080546910 11:33329656-33329678 AGGAGGGAAGGTAGAGAATATGG - Intronic
1080695202 11:34597690-34597712 CTGAGGGACAGGAGAGAGGAGGG + Intergenic
1080781493 11:35433844-35433866 ATGAGGGGATGGATAGATGGAGG + Intronic
1081463947 11:43299280-43299302 AGCAGGGAGGGGAGAGAAGATGG + Intergenic
1081548549 11:44091044-44091066 AGGAGGGAATAGAGAAAAGGAGG - Intergenic
1081654977 11:44851139-44851161 GTGAGTGCGTGGAGAGAAGAGGG + Intronic
1081792762 11:45800418-45800440 ATGGAGGAATGGACAGAAGTTGG - Intergenic
1081897326 11:46597713-46597735 AGGAGGGAGGGGAGAGAACAGGG + Intergenic
1082229766 11:49749079-49749101 ATGAAAGACTGGAGAGGAGATGG - Intergenic
1083224658 11:61277066-61277088 TGGAGGGAAGGGAGAGAGGAAGG + Intronic
1083235564 11:61348630-61348652 GTGAGGTTATGGTGAGAAGATGG + Exonic
1083311609 11:61786614-61786636 ATGAGTCAATGGAGGGCAGACGG + Exonic
1083400196 11:62418255-62418277 AAGAAGGAATGGCCAGAAGAAGG + Intronic
1083673797 11:64314456-64314478 ATGAGTGAGTGAAGAGACGAAGG - Intronic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084312969 11:68327245-68327267 GTGAGGAAATGGAACGAAGAGGG - Intronic
1084462988 11:69306637-69306659 ATTAGGGAATGGAGGGAGCAAGG - Intronic
1084486697 11:69452329-69452351 AGGTGGGAAAGGAAAGAAGAAGG + Intergenic
1084867020 11:72067068-72067090 ATGAGGGAAAGAAGAGAAATAGG + Intronic
1085129234 11:74023553-74023575 ATGAAGGAAGGCAGAGAAGATGG - Intronic
1085806723 11:79643263-79643285 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1085971633 11:81599090-81599112 ATGAGAGAAGGGAGAGAATCAGG - Intergenic
1086022842 11:82252750-82252772 ATGATGGAATGGGGAGAATATGG - Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086620310 11:88880046-88880068 ATGAAAGACTGGAGAGGAGATGG + Intronic
1086962431 11:92992443-92992465 ATGAGAGGAGGGAGAGAAGCAGG - Intergenic
1087350651 11:97027676-97027698 ATGCAGGAAAGGAGAGAAGTAGG - Intergenic
1087772548 11:102226323-102226345 ATGAGGGGAGAGAGAGAACAAGG + Intronic
1087906100 11:103699707-103699729 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088695171 11:112360274-112360296 ATGATGGGATGGAGAGAACATGG + Intergenic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089232484 11:116991493-116991515 TTGAGGGAAGGGAGAGAAACAGG + Intronic
1089300492 11:117495848-117495870 AGCATGGAATGGAGAGAAAACGG - Intronic
1089566975 11:119376810-119376832 ATGTGAGACTGCAGAGAAGATGG - Intronic
1089737049 11:120556784-120556806 AGGAAGGAACGGAGAGGAGATGG - Intronic
1089911100 11:122101496-122101518 AAAAGGGAAGGGAGAGAAAAAGG - Intergenic
1090230068 11:125095989-125096011 TTGAGGGAATTGAGACAAGCTGG - Intergenic
1090509043 11:127352523-127352545 AAGATGGAAGGAAGAGAAGAAGG - Intergenic
1090579962 11:128148794-128148816 ATGAGGGAGTAGGGAGCAGAGGG + Intergenic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090699694 11:129282538-129282560 GATAGGGAAAGGAGAGAAGATGG - Intergenic
1090718212 11:129449352-129449374 ATGGAGTAATGGAGAGAAGCAGG + Intronic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091102501 11:132888090-132888112 AAGGGGGAATAAAGAGAAGAGGG + Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091285669 11:134407385-134407407 ATGGGGGAGTGGAGACATGACGG - Intronic
1091568422 12:1663789-1663811 AGGAGGGAAAGGAGGGAAGGAGG + Intergenic
1091770622 12:3148879-3148901 AGGAGGGGATGAGGAGAAGAGGG + Intronic
1092051951 12:5477725-5477747 AGAAGGAAATGGAGGGAAGAGGG - Intronic
1092203782 12:6603413-6603435 AGAAAGGAGTGGAGAGAAGAAGG + Intronic
1092218836 12:6699854-6699876 ATGGGGGCATGGTGGGAAGAAGG + Intronic
1092278617 12:7081931-7081953 AGGAGAGAGAGGAGAGAAGAGGG - Intronic
1092296320 12:7201998-7202020 ATGAGGGAATGAACACTAGAAGG - Intronic
1092313928 12:7389522-7389544 ATGGGGGGCTGGAGAGAAGGTGG + Intronic
1092352870 12:7770058-7770080 AAGCAGAAATGGAGAGAAGAAGG + Exonic
1092474894 12:8810077-8810099 ATGAGGGTATGGAGAGATAATGG - Intergenic
1092549874 12:9486883-9486905 ATAAGAGAGTGGAGAGAAGCAGG + Intergenic
1092910235 12:13139845-13139867 ATGAGGGAATGGATGTAGGACGG - Intronic
1093128661 12:15362058-15362080 ATATGAGAATGGAGAGAAGGAGG - Intronic
1093791685 12:23258641-23258663 AAGAGGCAATAGAGAAAAGAAGG + Intergenic
1094000950 12:25693457-25693479 ATGAAGGAAAGGAGAGAAGGAGG + Intergenic
1094526571 12:31234982-31235004 AGGAGGGAAGGAAGAGAAAAAGG + Intergenic
1095201816 12:39393535-39393557 ATGAAGCAAGGCAGAGAAGACGG - Intronic
1095483310 12:42658352-42658374 ATTAACGAATTGAGAGAAGAAGG - Intergenic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096093780 12:48920881-48920903 ATTAGGAAAGGGAGTGAAGAGGG - Intronic
1096233340 12:49909703-49909725 GTGAGGCCAAGGAGAGAAGAAGG + Intergenic
1096284101 12:50283354-50283376 AAGAGGGTGTGGAGAGAAGCCGG + Intronic
1096690867 12:53321109-53321131 TAGAGGGAATGGAGAGAATGAGG - Intronic
1096751665 12:53763109-53763131 ATGAGGGAATAGAAAGAACCAGG + Intergenic
1096784046 12:54007068-54007090 ACGAGGGAAGGGTCAGAAGAGGG - Intronic
1097032876 12:56102115-56102137 GAGAGGGAATAGGGAGAAGACGG - Exonic
1097234875 12:57532531-57532553 CTGAGGGAGTGGAAAGGAGATGG + Intronic
1097280608 12:57843698-57843720 AGGACGGAGTGGGGAGAAGAAGG + Intronic
1097602180 12:61706792-61706814 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1097712800 12:62934313-62934335 AAGAGGGAGTGGGGAGAAGAGGG + Intronic
1098140230 12:67443525-67443547 AGGGGGGATTGTAGAGAAGAAGG + Intergenic
1098722476 12:73918444-73918466 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1098907990 12:76181048-76181070 AAGAAGGAAGGAAGAGAAGAAGG - Intergenic
1098918818 12:76284186-76284208 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1099037237 12:77603775-77603797 AGGAAGGAAAGGAGAGAGGAGGG - Intergenic
1099393543 12:82110070-82110092 AAGAGAGAGAGGAGAGAAGAAGG + Intergenic
1099492971 12:83308504-83308526 CTGAGGGAATGCAGTGAAAAGGG - Intergenic
1099533160 12:83812463-83812485 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1099552724 12:84068527-84068549 ATGAGGGAAATGAGGAAAGAGGG + Intergenic
1099568788 12:84286244-84286266 ATAAGGGAATGGAGAGAAATAGG - Intergenic
1099693429 12:85991250-85991272 AGGAGAGGATGGAGAGATGATGG - Intronic
1099868064 12:88309487-88309509 AGGAGGGAAGGAAGAAAAGAAGG - Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100127206 12:91441787-91441809 ATGAGAAAAGGGAGAGAAGGAGG - Intergenic
1100643313 12:96503358-96503380 AGGAGGGAAGGGAGAGAGGGAGG - Intronic
1100657608 12:96663290-96663312 GTGAAGAAATGAAGAGAAGAGGG + Intronic
1100689247 12:97021983-97022005 ATGGAGGGAGGGAGAGAAGAAGG - Intergenic
1100748059 12:97667300-97667322 AGGAAGGAAGGGAGGGAAGAGGG + Intergenic
1101035861 12:100705811-100705833 AGGAGGGAAGGAAGAGAGGAAGG - Intergenic
1101141285 12:101798307-101798329 AGGAGGGCATGTAGAGTAGAAGG - Intronic
1101212754 12:102551057-102551079 AAGAGAGAAGGGAAAGAAGAGGG - Intergenic
1101784404 12:107870302-107870324 GAGAGGGAATGGAGAGACGTAGG + Intergenic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102047606 12:109839793-109839815 ATGAAGGAAGGGAGAGAGCAGGG - Intergenic
1102131991 12:110538884-110538906 ATAAGGGAATAGAGAGTAGAAGG - Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1102409212 12:112702640-112702662 AAGAGTGACTGAAGAGAAGAGGG + Intronic
1102432898 12:112897498-112897520 ATCATGGAAGGGAAAGAAGAGGG - Exonic
1102443354 12:112980382-112980404 AGGAGGAAATGAAGAGAAGTTGG - Intronic
1102514588 12:113437855-113437877 ATCGGGGGATGGAGAGAGGAAGG - Intronic
1102681022 12:114690794-114690816 AGAAGGAAATGGAAAGAAGAGGG - Intergenic
1102992038 12:117322460-117322482 AGGAGGGAAGGGAGAAAGGAAGG - Intronic
1103019135 12:117519713-117519735 AGGAGAGAAAGAAGAGAAGATGG + Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103184909 12:118948391-118948413 ATGAAGGAAAGAATAGAAGACGG + Intergenic
1103255819 12:119540540-119540562 TTGAGGGGAGGGAGAGAAGGTGG + Intronic
1103366811 12:120389705-120389727 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1103367023 12:120390801-120390823 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1103652433 12:122443398-122443420 AGGAGGGAATGAAGAAAGGAAGG - Intergenic
1103688538 12:122752152-122752174 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1103870745 12:124089862-124089884 ATGAGCAAATGGAGAAAAGAGGG - Intronic
1104066808 12:125313498-125313520 ATGAAGGAAGGGAGAGAGAAAGG - Intronic
1104106639 12:125666374-125666396 ATGGGAGAATGGAGAGGAGGTGG + Intergenic
1104278785 12:127354714-127354736 AGGATGGAATGGAGAGCAAAAGG - Intergenic
1104463368 12:128971840-128971862 AGGGGGGAAGGGAGAGAGGAAGG - Intronic
1104629209 12:130386410-130386432 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629216 12:130386443-130386465 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629223 12:130386476-130386498 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629238 12:130386543-130386565 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629246 12:130386576-130386598 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629255 12:130386610-130386632 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629264 12:130386644-130386666 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629273 12:130386678-130386700 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629282 12:130386712-130386734 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629291 12:130386746-130386768 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629300 12:130386780-130386802 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629308 12:130386813-130386835 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629316 12:130386846-130386868 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629324 12:130386879-130386901 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629333 12:130386913-130386935 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629342 12:130386947-130386969 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629351 12:130386981-130387003 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629360 12:130387015-130387037 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629368 12:130387048-130387070 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629376 12:130387081-130387103 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629384 12:130387114-130387136 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629393 12:130387148-130387170 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629402 12:130387182-130387204 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629410 12:130387215-130387237 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629421 12:130387249-130387271 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629429 12:130387282-130387304 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629437 12:130387315-130387337 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629448 12:130387349-130387371 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629457 12:130387383-130387405 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629466 12:130387417-130387439 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629474 12:130387450-130387472 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629485 12:130387484-130387506 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629493 12:130387517-130387539 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629501 12:130387550-130387572 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629509 12:130387584-130387606 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629516 12:130387617-130387639 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629524 12:130387650-130387672 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104629533 12:130387684-130387706 ATGGGTGAATGGAGACAGGAAGG - Intergenic
1104678867 12:130735028-130735050 ATGAGTGGATGGAGAGAATGTGG - Intergenic
1104950421 12:132437472-132437494 AGGATGGAGGGGAGAGAAGAAGG + Intergenic
1104950432 12:132437504-132437526 AGGAGGGAGGGGAGAGACGAAGG + Intergenic
1105007349 12:132729553-132729575 GTGAGGGAAGGGGGAGATGAGGG + Intronic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105889946 13:24675543-24675565 TTGGGGGAATGGAGAGATGTAGG + Intergenic
1106178578 13:27351803-27351825 AGGAGGGAAGGAAGAAAAGAAGG - Intergenic
1106471705 13:30061743-30061765 AAGAAAAAATGGAGAGAAGAGGG - Intergenic
1106512280 13:30422000-30422022 ATGTGGGAGGGGAGAGAAGGAGG + Intergenic
1106765534 13:32909599-32909621 ATGAGGGGAGGGCTAGAAGATGG + Intergenic
1106780642 13:33056132-33056154 ATGATGCAATGGAGTGAAGCGGG + Intronic
1106886715 13:34193349-34193371 ATGAGGGAATGTATAGAGAAAGG + Intergenic
1106961886 13:35008674-35008696 ATGAGGAAATTGGGAGATGAGGG - Intronic
1107381561 13:39862179-39862201 GTGATAGAAAGGAGAGAAGAGGG - Intergenic
1107896624 13:44971257-44971279 ATGAGGAAATGGGGTGAAGATGG - Intronic
1107932072 13:45314951-45314973 AAGAAGGAAAGGAGAGGAGAGGG + Intergenic
1108316254 13:49240609-49240631 ATGAGAGGATGGATAGGAGAGGG - Intergenic
1108494846 13:51015103-51015125 ATGAGGGAAGAGATATAAGAAGG - Intergenic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108697049 13:52911631-52911653 TAGAGGGTATGCAGAGAAGAAGG + Intergenic
1109690240 13:65878589-65878611 ATGAGGCAATGGAGAAAAAAAGG - Intergenic
1109943479 13:69402281-69402303 ATAAAGGAAAGGAGAGAAGAAGG + Intergenic
1110227100 13:73131175-73131197 TTGAGGGGAAGGAGAGAATATGG + Intergenic
1110255129 13:73425368-73425390 AAAAGGGAATGGAGGGAGGAAGG - Intergenic
1110706912 13:78607720-78607742 AGGAAGGAATGGAGAAAGGACGG + Intergenic
1110724686 13:78806715-78806737 AGGAGGGAATGAAGTGAAGTTGG + Intergenic
1110823160 13:79939989-79940011 ATGTGGGAGTGAAGAAAAGAAGG + Intergenic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1110879492 13:80553861-80553883 ATAAGGGAATGGAAAGAAATTGG - Intergenic
1110884831 13:80619624-80619646 CTGAGGCAATGGCAAGAAGAGGG - Intergenic
1110964093 13:81669417-81669439 AGGAGGGAATGAGGAAAAGAAGG + Intergenic
1111048411 13:82846736-82846758 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1111110944 13:83708590-83708612 ATGAGAGAATGGATACATGAAGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111202526 13:84959281-84959303 GTGGGGGAATGGAGAGATGTTGG - Intergenic
1111358548 13:87144032-87144054 ATGAGAGAAAGTAGAGAAGGGGG - Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1112416304 13:99206086-99206108 GAGAGGGAATGCAGAGAAGCAGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112726214 13:102307766-102307788 ATGAGGGAATTGAGACAGAAAGG + Intronic
1112849547 13:103688153-103688175 AGGAGGGGATAGAGAGAAGTTGG - Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113094127 13:106645755-106645777 ATGATGGAATGGAGAATTGAAGG + Intergenic
1113140947 13:107148490-107148512 AGGAGGGGAAGGAGAGAAAAAGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113658930 13:112090715-112090737 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1114261392 14:21039151-21039173 AAGGGGGAAGGGAGAGAGGAGGG - Intronic
1114576483 14:23719114-23719136 AAGAGGAAAAAGAGAGAAGAAGG + Intergenic
1114593393 14:23890752-23890774 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1114615499 14:24065804-24065826 ATGAGGGAGTGGGAAGGAGAGGG - Intronic
1114767316 14:25388562-25388584 ATGAGGGAAAGTGGAGGAGAGGG + Intergenic
1115099634 14:29683124-29683146 AGGAAGGATTGCAGAGAAGATGG + Intronic
1115101632 14:29708197-29708219 ATGAGGCAATGGGGAGTTGAAGG + Intronic
1115114297 14:29861207-29861229 AAAATGGAATGGAGAAAAGAGGG + Intronic
1116842925 14:49837683-49837705 ATTAAGGAATCTAGAGAAGACGG - Intronic
1116915712 14:50523599-50523621 ATGCCTGAATGGAGTGAAGAAGG - Intronic
1117114176 14:52492784-52492806 AAGGGGGAATGGTGAGAAGGTGG - Intronic
1117353011 14:54899810-54899832 GTCAGGGACTGGCGAGAAGAGGG - Intronic
1117885913 14:60362618-60362640 ATGAGGGACTGGTGAGTTGAGGG - Intergenic
1118012706 14:61626278-61626300 ATGAGTGAGAGGAGAGAGGATGG - Intronic
1118036163 14:61869795-61869817 GTGAGGTTATGAAGAGAAGATGG + Intergenic
1118225025 14:63890564-63890586 ATGAGGGGAGGGAGACAGGAGGG + Intronic
1118615331 14:67571316-67571338 GTGAGAGTATGGGGAGAAGATGG - Intronic
1118970433 14:70632168-70632190 AACAGGGAATGGACAGCAGAGGG + Intergenic
1119223147 14:72925409-72925431 ATGAGGGAAATGAGAGAAGTGGG - Intergenic
1119931480 14:78551755-78551777 AGTGGGGAAGGGAGAGAAGAGGG - Intronic
1120016047 14:79474797-79474819 AACAGGGAAAGAAGAGAAGAAGG + Intronic
1120143926 14:80958556-80958578 AGCAGGGAAAGGAAAGAAGAAGG + Intronic
1120264684 14:82233975-82233997 ATGGGGGAATGGACAGTAGGTGG - Intergenic
1120414942 14:84207487-84207509 ATGAAGGAAGGGAGAAAAGGGGG - Intergenic
1120487798 14:85136896-85136918 ATGAGGAAATGGAGAGATGGTGG + Intergenic
1120515198 14:85462218-85462240 ATGAAGGAAAGAAGAAAAGAAGG - Intergenic
1120764444 14:88315890-88315912 ACAAGGGAATGAAGAAAAGAAGG + Intronic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1120848506 14:89147490-89147512 GTGGGGGAATGGATAAAAGAGGG + Intronic
1120915496 14:89706578-89706600 GTGAGGTAATAGTGAGAAGATGG - Intergenic
1121099802 14:91242601-91242623 ATGAGGGAATGGGTGGCAGATGG + Intronic
1121321823 14:92995961-92995983 ATGACGGAATGGTGCCAAGAGGG - Intronic
1121627177 14:95394421-95394443 ATGAGTGAATGGAGGGTTGAAGG + Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1121955331 14:98207927-98207949 AGAAGGGAAGAGAGAGAAGAGGG + Intergenic
1122080378 14:99263000-99263022 AGAAGGAAATGGAGATAAGAGGG + Intronic
1122254228 14:100464871-100464893 ATGAGGTAAAGGAGATGAGATGG - Intronic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123952490 15:25294958-25294980 CTGGGGGAATGTAGAGAAAAGGG + Intergenic
1123990605 15:25680541-25680563 AGGAGGGAAAGGAGAGAATGTGG + Intronic
1124103292 15:26715055-26715077 CTGAGGGCATGCAGACAAGAGGG + Intronic
1124583877 15:30987843-30987865 ATGAGGGAAGGGAGAGCATTAGG - Intronic
1124621254 15:31275361-31275383 ATGAGGAACTGTAGAGGAGAGGG + Intergenic
1124964614 15:34423847-34423869 ATGAGGGGGTAGGGAGAAGAGGG - Intronic
1125666476 15:41434536-41434558 ATGAGAGAATTGAGGGATGATGG + Intronic
1125697492 15:41651642-41651664 AAGGGGGAAGGGAGAGGAGAGGG - Intronic
1125697500 15:41651661-41651683 AAGGGGGAATGGGGAGGAGAAGG - Intronic
1125796549 15:42408196-42408218 ATGATGGGCTGGAGAGAGGAGGG - Exonic
1125828996 15:42699297-42699319 AAGAGGGAATGGGGAGTGGATGG - Intronic
1125971832 15:43918050-43918072 ATCAGGAAATGGGGAGAGGAGGG - Intronic
1126167604 15:45666929-45666951 ATGGGAGAAAGGAGAGGAGAGGG - Intronic
1126320641 15:47419041-47419063 AAGCTGGAAAGGAGAGAAGAGGG + Intronic
1126454839 15:48849721-48849743 ATGACGGAAAGGAGAGAGGAAGG + Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127192308 15:56543403-56543425 AAGAGGGAAAGGAAAGAGGAGGG + Intergenic
1127300860 15:57652159-57652181 ATGAAGGAATGGAGGGAAAAAGG - Intronic
1127359441 15:58232027-58232049 ATGATGGAAAGGAGGGAACAAGG + Intronic
1127517818 15:59713404-59713426 AGGAGGGAAGGGAGGAAAGAAGG - Intergenic
1127756187 15:62094601-62094623 ATGAGAGAATGGAGGGGAGAGGG + Intergenic
1127897055 15:63310472-63310494 AGGTTGGAAAGGAGAGAAGAAGG + Intergenic
1127932992 15:63609722-63609744 ATGAGGACAGGGAGAGGAGAGGG - Intronic
1128004235 15:64223419-64223441 ATGAGGGAATGGAAAGGAAGTGG + Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128166624 15:65470933-65470955 AAGAGGGAAAATAGAGAAGAGGG + Intronic
1128403563 15:67311902-67311924 ATGAGTGGACAGAGAGAAGAGGG + Intronic
1128440303 15:67701133-67701155 ATGAAGAAATGGAGAGAGGAAGG + Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1130392111 15:83466030-83466052 AGGAGGGAATGGAGGCAGGAAGG - Intronic
1130418553 15:83717541-83717563 GTAAGGGAAGGGAGAAAAGAAGG + Intronic
1130423142 15:83768392-83768414 ATGGAGGGAGGGAGAGAAGAAGG + Intronic
1130430784 15:83844963-83844985 ATTAGGGAATGAGGAGCAGATGG - Intronic
1130533552 15:84766539-84766561 GAGAGGGGAAGGAGAGAAGAGGG + Intronic
1130749863 15:86700041-86700063 ATAATGAAATGGGGAGAAGAGGG - Intronic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130847135 15:87758090-87758112 ATGAAGGAAGGGAGGGAGGAAGG + Intergenic
1130929844 15:88416258-88416280 CTGAGAGAATGGTCAGAAGAGGG - Intergenic
1130941264 15:88511230-88511252 TGGAGGGAATAGAGAGTAGAGGG - Intergenic
1131111019 15:89765606-89765628 AGGAGAGAAAGGAGAGAAAAAGG + Intronic
1131205254 15:90439888-90439910 ATGAGGGGTTGGGGAGAAAAAGG + Intronic
1131793329 15:95988380-95988402 AGAAGGGAAGGGAGGGAAGAGGG + Intergenic
1131983282 15:98016796-98016818 GAGAGGGAAGGGATAGAAGAGGG - Intergenic
1131985720 15:98041549-98041571 ATGAGGGAATTCAGGAAAGAGGG - Intergenic
1132020417 15:98356557-98356579 AGGAAGGGATGGAGAGAGGAAGG + Intergenic
1132088935 15:98931938-98931960 ATGATGGAATTGATAGAACAAGG + Intronic
1132272243 15:100536630-100536652 ATTAGGAAATGGACAGAAGTCGG + Intronic
1132355505 15:101168470-101168492 ATGAGAGAATTGACAGAAGCTGG - Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1132618554 16:853970-853992 ATGAGGGATAGGACAGAAAATGG + Exonic
1133326840 16:4947113-4947135 ATGGAGGAATGGAGGGATGAAGG - Intronic
1133361738 16:5179470-5179492 GTGAGGGTATGATGAGAAGATGG - Intergenic
1133470331 16:6069023-6069045 ATGAAGGAAGGGAGAAAGGAAGG + Intronic
1133517448 16:6523244-6523266 AGGAGGGAAGGAAGAGAAGAAGG + Intronic
1133702548 16:8322595-8322617 ATGAAGGGATGGAGAGAAGGTGG - Intergenic
1134202545 16:12210776-12210798 AAGAGAGAAGGGAGAGAGGAGGG - Intronic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1135077576 16:19407371-19407393 ATGAGGGAGTGGGGAGCAGCGGG + Intergenic
1135565477 16:23508388-23508410 AGGAGGCAATGGAGAACAGAAGG - Intronic
1135637903 16:24094794-24094816 ATGAAGGAAGGGAGGGAGGAAGG + Intronic
1135728191 16:24873224-24873246 AGGAAGGAATGGAGAGAGGGAGG + Intronic
1135784433 16:25336007-25336029 AGGAAGGAAAGAAGAGAAGAAGG - Intergenic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1135943175 16:26840566-26840588 AAGGGGGAAGGGAGAGAAGATGG + Intergenic
1136170054 16:28483679-28483701 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1136291063 16:29271652-29271674 ATGAGGGAGGGGAGAAAAGAAGG + Intergenic
1136483837 16:30558469-30558491 ATGAGGGTACGGAGAGAACGCGG - Intronic
1137033186 16:35543942-35543964 AGGAGGGAGTGGAGAGAACCAGG - Intergenic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1137458747 16:48638593-48638615 ATGAGGACGTGGGGAGAAGACGG + Intergenic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137555740 16:49469248-49469270 ATGAAGGCCTGGAGAGAGGAGGG - Intergenic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1137570910 16:49565867-49565889 AGGAGAGAATGGAGAGGAGAGGG + Intronic
1137574899 16:49593062-49593084 ATGGGGGAGTGAAGAGAAGGGGG + Intronic
1137710354 16:50562715-50562737 CTGAAGGAAAGGAGAGAGGAGGG + Intronic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1138044338 16:53705136-53705158 TTGAGGGAAGGGAGAGAAGGTGG - Intronic
1138202555 16:55100972-55100994 AGGAAGGAATGGAGGGAAGAAGG + Intergenic
1138263098 16:55639727-55639749 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
1139210071 16:65068183-65068205 AGGAAGGAAATGAGAGAAGAAGG + Intronic
1139240735 16:65389401-65389423 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1139316409 16:66073730-66073752 TTGAGGGAGTGGAAAAAAGAAGG + Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139657877 16:68399912-68399934 ATGAGGCTACGGAGAGAAGCTGG - Intronic
1139676279 16:68526221-68526243 AGGAGGGAAGGGAGAGGAGGCGG - Intergenic
1139684304 16:68590776-68590798 AGGAGGGAAGGGAGAAAAGAAGG - Intergenic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140288699 16:73629562-73629584 AGGAGGGAATGAGAAGAAGATGG + Intergenic
1140567926 16:76066137-76066159 AGTATGGAATGGAGAGCAGAGGG - Intergenic
1140866838 16:79069750-79069772 ATTAGGGAAAGAAGAGAAGCCGG + Intronic
1140981283 16:80112152-80112174 AGCAGGGAATGGAGTGCAGAGGG + Intergenic
1141134775 16:81458142-81458164 ATGAGGAAGTGGGGAGGAGAGGG + Intronic
1141137006 16:81473022-81473044 CTGAGGGTATGCAGAGGAGATGG - Intronic
1141506844 16:84483567-84483589 ATGATGGAACGCAGATAAGAAGG + Intronic
1141563548 16:84886209-84886231 ATGAGGGAATGAAGAGAGGCGGG - Intronic
1141646477 16:85370591-85370613 AGGAGGGAGGGAAGAGAAGAGGG - Intergenic
1141732804 16:85834065-85834087 ATGAAAGAAGGGAGAGAAGGAGG + Intergenic
1141856215 16:86683075-86683097 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1141942513 16:87286963-87286985 AGGAGGGAAGGGAGAGGAGCGGG + Intronic
1142096933 16:88245126-88245148 ATGAGGGAGGGGAGGAAAGAAGG + Intergenic
1142135023 16:88447960-88447982 AAGAAGGAAGGGAGGGAAGAGGG + Intergenic
1142135037 16:88448011-88448033 AGGAGGGAGAGGAGAGAGGAAGG + Intergenic
1142137759 16:88459548-88459570 AGGGGGGAATGAAGAGAAGGAGG - Intronic
1203087445 16_KI270728v1_random:1191787-1191809 AAGAGGGCATGGAGAGGGGAGGG + Intergenic
1142972386 17:3621583-3621605 GGGAAGGAATGGAGAGAAGGAGG - Intronic
1143179532 17:4975441-4975463 AAGAAGAAATGGAAAGAAGAGGG + Intronic
1143356664 17:6334793-6334815 TTGATGGAAGGGAGAGAGGAAGG + Intergenic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143904769 17:10199255-10199277 GGGACGGAATGGAGAGAAGACGG + Intergenic
1144066313 17:11627717-11627739 AAGTGGGAGGGGAGAGAAGAGGG - Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1145721702 17:27079256-27079278 AAGAGGGAAAGCTGAGAAGAGGG + Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146498861 17:33347211-33347233 ACGAGGAAAGGCAGAGAAGATGG + Intronic
1146607225 17:34271060-34271082 AACAGGGAATGGTAAGAAGAAGG - Intronic
1146645027 17:34571565-34571587 AGGAGGCCATGGAGAGAAGTTGG + Intergenic
1146788249 17:35736198-35736220 GAGAGGGAGTGGAGAGAAAAAGG + Intronic
1147031966 17:37645759-37645781 ATGTGTGAATGGAGAAGAGAAGG + Intergenic
1147176775 17:38660694-38660716 AGGAGCTTATGGAGAGAAGAGGG - Intergenic
1147334768 17:39720574-39720596 AAGGGGGTATGGAGAGGAGAGGG + Intronic
1147446182 17:40476566-40476588 ATCAAGGAATGGAAAGAAGCTGG + Exonic
1147893022 17:43730642-43730664 ATGGGGAAACGGGGAGAAGATGG + Intergenic
1147979094 17:44263689-44263711 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1148255799 17:46130791-46130813 ATGAGGGAGGGGAAAGAGGAGGG - Intronic
1148806442 17:50266416-50266438 ATGGGGGAATGGTGAGCAGGGGG - Intergenic
1149217840 17:54378657-54378679 AGGAAGGAAAGGAGAGAGGAAGG + Intergenic
1150179124 17:63096428-63096450 TTGAAGAAATGGAGAGAACATGG + Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151377932 17:73704158-73704180 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1151524205 17:74652750-74652772 ACCATGGAAAGGAGAGAAGATGG - Intergenic
1152003216 17:77660286-77660308 AAGAAGGAAAGGAGGGAAGAAGG - Intergenic
1152003235 17:77660436-77660458 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1152094771 17:78266729-78266751 ATGAGGAAACGGATAGCAGAGGG + Intergenic
1152227658 17:79100062-79100084 ATCAGGGAATGGAGGGAGGTGGG - Intronic
1153129430 18:1837766-1837788 ATGAGGGAATGGAAAGATGGGGG - Intergenic
1153250399 18:3116076-3116098 AGGAGAGAAAGGAGAGAGGAAGG + Intronic
1153549314 18:6244734-6244756 TTGAGGGAATGGGGAGATGCTGG + Intronic
1155040397 18:22060537-22060559 ATTAGGAAATGGAAAAAAGAGGG + Intergenic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1155897289 18:31346139-31346161 ATGAGGGAATGTAGAGAAGGAGG + Exonic
1156071955 18:33222312-33222334 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
1156568294 18:38221522-38221544 ATGGGGAAAAGGAGAGAAGGGGG + Intergenic
1156597746 18:38566702-38566724 ATGGAGGAAGGGAGAGAGGAAGG + Intergenic
1156660877 18:39345118-39345140 GAGAGGAAAGGGAGAGAAGAGGG + Intergenic
1156825249 18:41423340-41423362 AAGAGGGACTGGAGAAAAAAAGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157583185 18:48785161-48785183 AGGAGGGAAAAGAGAGAGGAAGG - Intronic
1157757669 18:50232856-50232878 AGGAAGGAATGGAGAGGAAAAGG - Intronic
1157837097 18:50914851-50914873 AAGAAGGAAGGGAGAGAAGGAGG - Intronic
1157915184 18:51657421-51657443 AGGAAGGAATGGAAAGAAGGAGG - Intergenic
1158058711 18:53312957-53312979 AGGAGGGAGTGGGGAGAGGAAGG + Intronic
1158197150 18:54900780-54900802 AGGAAGGAAGGGAGACAAGAAGG + Intergenic
1158334934 18:56405743-56405765 AGGAGGGAAGGGAGAGAGGGAGG + Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159283112 18:66312307-66312329 AAGAAGGAATGAAGAAAAGATGG + Intergenic
1159356097 18:67338377-67338399 ATGAAGGAATGGAGGAAGGAAGG - Intergenic
1159394434 18:67838124-67838146 AAGAAGGAAGGGAGAAAAGAAGG - Intergenic
1160177276 18:76605728-76605750 ATGAGTGAATGGATAGAAGGTGG - Intergenic
1160519622 18:79497159-79497181 AAGAAGGACTGGAGAGAAGCAGG + Intronic
1160612825 18:80101769-80101791 TTGAGGTGATGGTGAGAAGATGG + Intergenic
1161139597 19:2639720-2639742 GGGAGGGAAGGGAGAGAAGGAGG + Intronic
1161329150 19:3678197-3678219 ATGAAGGGATGGAGAGATGGAGG + Intronic
1161370605 19:3908850-3908872 ATGAGGGAAGGAGGAGAAGGAGG - Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162164937 19:8745942-8745964 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162166008 19:8753406-8753428 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162167074 19:8760862-8760884 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162168140 19:8768329-8768351 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162169082 19:8774618-8774640 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162169760 19:8779929-8779951 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162170826 19:8787388-8787410 AAGAGGGAAGGGAGGGAGGAAGG - Intergenic
1162274007 19:9638800-9638822 AAGAGGGGATGCAGAGGAGAAGG + Intronic
1162292825 19:9792284-9792306 CTCAGTGAAGGGAGAGAAGAGGG - Intronic
1162793311 19:13074050-13074072 TGGGGGGAGTGGAGAGAAGATGG - Intronic
1162872716 19:13598567-13598589 AAGAGGGAAAGGAGAGAGGGAGG + Intronic
1163094966 19:15050578-15050600 ATGAAGGAATGGATAGAAGGAGG + Intronic
1163297649 19:16422503-16422525 ATGAGGGAGTGGAGAGAAAAAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164441260 19:28282350-28282372 AAGAGAGAATGGGGAGAAAATGG - Intergenic
1164684236 19:30156610-30156632 ATGAGGGAATGGGGTTCAGAGGG + Intergenic
1164730943 19:30504218-30504240 AGGAAGGAAGGGAAAGAAGAAGG - Intronic
1164866861 19:31611591-31611613 AAGAGGGAGAGGAGAGAGGAAGG + Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1165940028 19:39410299-39410321 GGTAGGGAAAGGAGAGAAGAGGG - Intergenic
1166747777 19:45149899-45149921 ATGGGGGAAGGGAGTGGAGAAGG + Exonic
1166771798 19:45287770-45287792 ATGAATGAATGGGTAGAAGAAGG - Intronic
1167084590 19:47300632-47300654 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168319291 19:55499726-55499748 GTGAGTGACTGGAGAGAAGGAGG + Intronic
1168387110 19:55973463-55973485 ATGTGGGAATGGTGGGATGAAGG - Intronic
924963903 2:58137-58159 AGGAGAAAATGGAGAGATGATGG + Intergenic
925149200 2:1602947-1602969 GTGAGGTTATGGTGAGAAGACGG - Intergenic
925199201 2:1952758-1952780 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
925199234 2:1952857-1952879 AGGAGGGAAGGGAAAGAAGGAGG - Intronic
925428289 2:3769439-3769461 CTGATGGAATGGAGTGAAGACGG - Intronic
925537077 2:4929308-4929330 ATGAGGGGAAGCAGAGAAAAGGG + Intergenic
925602737 2:5625753-5625775 ATGAGGGAATGGAGAGCAGGTGG + Intergenic
925645113 2:6027920-6027942 ATGAGGAATTGAAGAGAAGAGGG - Intergenic
925651251 2:6091891-6091913 AAGATGGAATTGAGAGAAGGAGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
925925719 2:8668548-8668570 ATGAGGGGATGGATGGATGAGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926120750 2:10240068-10240090 ATGGGGGAATGGTTAGAAGGAGG + Intergenic
926137061 2:10343821-10343843 ATGAGGGCAGAAAGAGAAGAGGG + Intronic
926542850 2:14202929-14202951 AGGAAGGAATGGAGGGAGGAAGG + Intergenic
926687790 2:15711333-15711355 ATGAGGGGATAGAGAGAAATCGG + Intronic
926792080 2:16584305-16584327 ATGAGGGAACAGAGTGAAGCGGG - Intronic
926812835 2:16771641-16771663 AGGAGGGAAGGAAGACAAGAAGG + Intergenic
926887689 2:17613008-17613030 TTAAGGGAATGAAGAGGAGATGG - Intronic
927220654 2:20705483-20705505 AAGAGGGGATGGAGAAAACAGGG - Intronic
927287269 2:21369826-21369848 AGGAGGTAATGGAGGGAAGGAGG - Intergenic
927445561 2:23158060-23158082 ATCCAGGAATGGAGAGAACAGGG - Intergenic
927476345 2:23417108-23417130 CAGAGGCAATGAAGAGAAGAAGG - Intronic
927664315 2:25019464-25019486 AGAAGGGAATGGAGAGGAGGGGG - Intergenic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
928276465 2:29905524-29905546 AAGAGGGAAGGAAGAGAAGGAGG + Intronic
928426608 2:31183779-31183801 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
928500510 2:31888810-31888832 ATGAGGGGATTGAAAGAAGGGGG + Intronic
928766343 2:34651012-34651034 ATGATGCAATGGAAAGAAGAGGG + Intergenic
928896170 2:36266295-36266317 AGTAGGGACTGGACAGAAGAAGG - Intergenic
928965729 2:36973419-36973441 TTGAGGGCCTGGAGAGTAGAGGG - Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929626395 2:43413119-43413141 AGGATAGAAAGGAGAGAAGAGGG - Intronic
929782248 2:44964746-44964768 ATGAGGGAAGGGCAAGAAAAGGG - Intergenic
930107800 2:47653716-47653738 AGGAAAGAATGGAGGGAAGAGGG - Intergenic
930365414 2:50433667-50433689 AAGAGAGAAAGGAAAGAAGAAGG + Intronic
930424958 2:51201601-51201623 AGGAGGGAATGAAGAGAGAAAGG - Intergenic
930649136 2:53946924-53946946 AGGAAGGAAGGGAGAGAGGAAGG + Intronic
930892031 2:56401210-56401232 GTGAGGGCAAGGATAGAAGAAGG - Intergenic
931039422 2:58280536-58280558 ATGAAGGAAGGAAGAAAAGAAGG + Intergenic
931061005 2:58529933-58529955 ATGAAGAGATGAAGAGAAGAAGG + Intergenic
931063695 2:58560380-58560402 ATGAAGAAATGGAGAAAGGATGG + Intergenic
931270038 2:60693508-60693530 ATAAGGGATTGGAGAGAAAGAGG + Intergenic
931332269 2:61299970-61299992 AGTAGGGAATGAAGAGGAGAAGG - Intronic
931949661 2:67348860-67348882 ATCAGAGAATGGAGAGAGTAGGG - Intergenic
932054724 2:68432732-68432754 AAGAGAGGATGGAGAGATGATGG - Intergenic
932196554 2:69788857-69788879 AAGAGGGAAAGAAGGGAAGAAGG + Intronic
932321116 2:70822654-70822676 TTGAAGTAATGGAGACAAGAAGG - Intergenic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932589777 2:73058420-73058442 ATGGGGGAGTGAAGAGAATAGGG - Intronic
932738837 2:74276130-74276152 AAGAGAGAAAGGAGAGGAGAAGG + Intronic
932768837 2:74489322-74489344 AGGAGGGATTGGAGAGCAGCTGG + Intronic
932808264 2:74801409-74801431 ATGAGGACATGGCGAGAAGGCGG + Intergenic
932854630 2:75220360-75220382 AAGAGGGCATGGAGAGATGTTGG - Intergenic
932932927 2:76063416-76063438 ATGAGGAAATAGAGAAAAGCAGG + Intergenic
933100983 2:78257106-78257128 AAGAGGGAATGAAGAGAAGCTGG - Intergenic
933117818 2:78497257-78497279 ATCTGAGAATGGACAGAAGAAGG + Intergenic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
933858754 2:86442905-86442927 ATGAGGGGAGGGAGAGAATTGGG + Intronic
934331824 2:92075314-92075336 ATGAGAGAAGGGAGGGAGGAAGG + Intergenic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
934996681 2:98968094-98968116 AAGAGGGAATGAAGAGAGGTTGG - Intergenic
935549017 2:104431934-104431956 CTGGGTGAATGGAGAGAAGCGGG + Intergenic
935571704 2:104669142-104669164 AAGAGGGAAGTGAGAGATGATGG + Intergenic
935623578 2:105149611-105149633 AAGAGTGAATGGATAAAAGATGG + Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
935985453 2:108668349-108668371 TGGAGGGGATGGGGAGAAGATGG - Intronic
936137883 2:109911996-109912018 TGGAGGGGATGGGGAGAAGATGG - Intergenic
936206814 2:110459489-110459511 TGGAGGGGATGGGGAGAAGATGG + Intronic
936599368 2:113880853-113880875 AGGATGGAAGGGAGAAAAGAAGG - Intergenic
936679837 2:114757302-114757324 AAGAGGGAAGGGAGAAAGGAGGG + Intronic
937005005 2:118503346-118503368 AGCAGGGAAAGGAAAGAAGAGGG + Intergenic
937052256 2:118902028-118902050 AGAAGGGAAGGAAGAGAAGAAGG - Intergenic
937153401 2:119701437-119701459 TTGAGGGGATTGAGAGCAGAGGG + Intergenic
937201779 2:120208729-120208751 ATGAGGGGATGGCCAGTAGAAGG - Intergenic
937300814 2:120840229-120840251 AAGAGAGAATGGACAGAAGCGGG - Intronic
937354403 2:121188910-121188932 ATGAGTGAATGGATAGATGAAGG + Intergenic
937460912 2:122084872-122084894 TTGAGGAAACGGAGAGAAAATGG + Intergenic
937479207 2:122241572-122241594 AGGAAGGAAGGGTGAGAAGAAGG + Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938076228 2:128340038-128340060 GGGAGGGAAGGGAGAGGAGAGGG + Intergenic
938112511 2:128578505-128578527 ATGAGGTGATGGAGAGGGGATGG - Intergenic
938180982 2:129182181-129182203 ATGAGGGAGTGGAAAGAGAAGGG - Intergenic
938258200 2:129876968-129876990 AAGAGGGAAGGCAGAGGAGAAGG - Intergenic
938262000 2:129903153-129903175 ATGAGGGGATGGGGAGGAGGGGG - Intergenic
938516120 2:132009493-132009515 ATGAGAGAAGGGAGGGAGGAAGG - Intergenic
938913520 2:135909583-135909605 TTGTTGGAATGGGGAGAAGATGG - Intronic
939115675 2:138057541-138057563 AGGAAGGAAAGAAGAGAAGAAGG - Intergenic
939278504 2:140032231-140032253 AGAAAGGAATGGAGAGAGGAAGG - Intergenic
939291311 2:140198904-140198926 ATGAGGAGAAGGGGAGAAGAAGG + Intergenic
939414686 2:141880110-141880132 GAGAGAGAATGGAGAGAATATGG - Intronic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
939959757 2:148556149-148556171 ATGGGGGAATGAAGAAGAGAGGG - Intergenic
940034184 2:149296021-149296043 AGGAGGGAAGTCAGAGAAGATGG + Intergenic
940656132 2:156489849-156489871 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
940670806 2:156665646-156665668 AGGAGGTAGGGGAGAGAAGAAGG - Intergenic
941124821 2:161571966-161571988 TTGATGAAATTGAGAGAAGATGG - Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
941339294 2:164286939-164286961 ATGAGGGAAGGAAGGAAAGAGGG + Intergenic
941565693 2:167103169-167103191 AGGAGGGAAGGGAGGGGAGAGGG + Intronic
942076517 2:172361124-172361146 ATGAAAGATTGGAGAGGAGAGGG + Intergenic
942393572 2:175522446-175522468 ATGAGGGAATGGATACCAGGAGG + Intergenic
942763800 2:179430146-179430168 TGGAGGGAATGGGGAGACGATGG + Intergenic
942904582 2:181165762-181165784 AGGAGGGAGAGGAGAGGAGAAGG + Intergenic
942997097 2:182276077-182276099 AGGAAGGAAGGGAGAGAGGAAGG - Intronic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499242 2:188666161-188666183 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
943554738 2:189388331-189388353 ATGATGGAAAGGAGACAGGAAGG + Intergenic
943812691 2:192209287-192209309 ATGAGTAAATGAAGAAAAGAAGG - Intergenic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
944185317 2:196941659-196941681 AGGAGGAAATGGAGAGAGCAAGG + Intergenic
944330329 2:198458040-198458062 AGGAGGGAAAAGAGAGTAGAAGG - Intronic
944388761 2:199194944-199194966 ATGAGGGAATGGGGAGGAGGAGG - Intergenic
944504936 2:200401598-200401620 ATGAGGCAAAGGAGAGAAGGTGG - Intronic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945385574 2:209195863-209195885 AGGAGGGAAGGGAGAGCAGCAGG + Intergenic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
945564175 2:211375990-211376012 ATGAGGGAAAGGAAGGAGGATGG + Exonic
946390127 2:219409985-219410007 GTCAGGGAAAGGAGAGAAGCTGG + Intergenic
946554817 2:220844242-220844264 ATAAGTGAATGGATACAAGAAGG - Intergenic
946760898 2:222992212-222992234 AGGAGGGACAGGAGAGATGAAGG + Intergenic
946970209 2:225082474-225082496 AAGAAGGAAGGGAGAGAAGTGGG + Intergenic
947422526 2:229953707-229953729 AAGAGGGGAAGGAGAGAGGAGGG + Intronic
947524329 2:230869206-230869228 ATCAGGGATGGAAGAGAAGAGGG + Intronic
948240176 2:236424794-236424816 ATCAGGGAATGGAGAGATGTTGG - Intronic
948582639 2:238998287-238998309 ATGAAGGAAGGGAGAGAAGGAGG - Intergenic
948646912 2:239411136-239411158 ATGAGGGAAGGTAGGGAAGGTGG - Intergenic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168889823 20:1287798-1287820 AAGGGGGAAGGGAGAGAAGCCGG + Intronic
1169361812 20:4956777-4956799 AAGAGGGAAGGGAGAGGGGAGGG - Intronic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169733311 20:8810425-8810447 ATGAGGGAGAGTATAGAAGAAGG + Intronic
1169948218 20:11012145-11012167 GTGAGGGTATGGTGAGAAAATGG - Intergenic
1170170794 20:13409950-13409972 AGGAGGGAATGAAGAGAGGTCGG - Intronic
1170195500 20:13685046-13685068 ATGGGGGAAGGGTGAGAAGATGG - Intergenic
1170357369 20:15507323-15507345 AGGAGGGAATTGGGAGAAGCAGG - Intronic
1170409517 20:16073591-16073613 ATGAGGGATGAGAGAGAAGAAGG + Intergenic
1170501806 20:16982418-16982440 AGGAGGGAAGGGAGGGAGGAGGG - Intergenic
1170501839 20:16982518-16982540 AGGAGGGAAAGAAGAAAAGAAGG - Intergenic
1170830484 20:19835153-19835175 AGGAAGGAATGAAGGGAAGAAGG + Intergenic
1171019459 20:21572084-21572106 TTGAGGGAGTGGAGAGAGAAGGG + Intergenic
1171107033 20:22444026-22444048 ATGAGAGAAAGGAAAGAGGAGGG - Intergenic
1171151867 20:22834710-22834732 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151904 20:22834857-22834879 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171151954 20:22835097-22835119 AGGAAAGAATGGAGGGAAGAAGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172025650 20:31946463-31946485 AGCAGGGACTGGAGATAAGAAGG - Intronic
1172725875 20:37041087-37041109 AGGAGGAATTGGAAAGAAGATGG - Intronic
1172845880 20:37929789-37929811 ATGTGGGAAGGGAGAGTGGAGGG + Intronic
1173048123 20:39532246-39532268 ATAAGAGAATGGAGAGAATTTGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173302271 20:41814740-41814762 ATGAGGGAAAGCAGAGATGGTGG - Intergenic
1173372038 20:42445224-42445246 ATGAGGAAATTGAGTGCAGAGGG - Intronic
1173590193 20:44219153-44219175 AGGAGGGAAAGGAGAAAGGATGG - Intergenic
1174104584 20:48153247-48153269 AGCAGGGAAGGGAGACAAGAGGG - Intergenic
1174283284 20:49454615-49454637 AGCAGGGAAGGGAGATAAGAAGG + Intronic
1174530028 20:51204267-51204289 TTGAAGGAATGCAGAGAAGTAGG - Intergenic
1174655359 20:52167490-52167512 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1174744698 20:53049675-53049697 AGGAAGGAAAGGAGAGACGAAGG + Intronic
1175062294 20:56254637-56254659 ATGAGGGGAAGGAGAGGAGAAGG + Intergenic
1175273912 20:57754499-57754521 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175474960 20:59265615-59265637 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1175496852 20:59420516-59420538 AGGAAGGAAGGAAGAGAAGAAGG - Intergenic
1175569925 20:60010725-60010747 AGGAGGAGATGGTGAGAAGAGGG + Intronic
1175615010 20:60390506-60390528 AGGAAGGAATGAAGGGAAGAAGG - Intergenic
1175983997 20:62755228-62755250 AGGAGTGAATGGAGGGAAGGAGG - Intronic
1176047633 20:63101033-63101055 AGGAGGGAGTGGGGAGAAGGAGG - Intergenic
1177003380 21:15640726-15640748 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1177295410 21:19166966-19166988 ATGTGGCAATGAAGAGAAGATGG + Intergenic
1177412919 21:20754336-20754358 ATGTGGGACTGGAGAGATGAAGG + Intergenic
1178021789 21:28416708-28416730 ATCAGGGAAAGGAAAGAAGAGGG - Intergenic
1178337987 21:31761089-31761111 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1178379854 21:32098869-32098891 AGGAGGGAAGAGAGAGAGGAGGG - Intergenic
1178803055 21:35815068-35815090 AGGAGGGAAGGAAGAGAAGAGGG - Intronic
1179027234 21:37689612-37689634 AGGAATGAATGGAGAGAGGAAGG - Intronic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179236735 21:39554141-39554163 AGGAGGACATGGAGAGAGGAAGG - Intergenic
1179279850 21:39925054-39925076 AAGGCTGAATGGAGAGAAGAGGG - Intronic
1180156118 21:45978023-45978045 AGGAGGGAAGGGGGAGAGGAGGG + Intergenic
1180195930 21:46194391-46194413 CTGAGTGAATGTAGAGAGGAGGG - Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180798618 22:18620629-18620651 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180881868 22:19209928-19209950 ATGGGGGAATGGGGAGTATAGGG + Intronic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181007027 22:20018484-20018506 ATGAGGTAACTGTGAGAAGAGGG - Intronic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181223098 22:21374635-21374657 AGGAAGGAAAAGAGAGAAGAAGG - Intergenic
1181255640 22:21560999-21561021 AGGAAGGAAAAGAGAGAAGAAGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181592309 22:23893049-23893071 TTCAGGGAATGGAGAGAAGTGGG + Intronic
1181613633 22:24036671-24036693 ATGAATGGATGGAAAGAAGAAGG - Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181759227 22:25046403-25046425 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1181759231 22:25046419-25046441 AGGAAGGGATGGAGAGAGGAAGG - Intronic
1182113580 22:27742080-27742102 AGGAGGGAAAGGAGAAAAGAGGG - Intergenic
1182118199 22:27769973-27769995 ATGAGGAAAAGGAGAGTCGATGG + Intronic
1182369644 22:29801914-29801936 ATGAGGGAAGGAAGAGAGGAAGG + Intronic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1182789404 22:32937155-32937177 ACGTGGAAATGGAGAGATGATGG + Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1183102712 22:35593665-35593687 GAGAGGGAAAGGAGAGAAAAGGG + Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183576939 22:38697192-38697214 AAGAGGTGAGGGAGAGAAGATGG - Intronic
1183625699 22:39000011-39000033 TGGAGGAAATGGAGAGAGGATGG - Intergenic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184103360 22:42353366-42353388 TTGGGGGAAGGGTGAGAAGAGGG + Intergenic
1184509368 22:44924098-44924120 AGGAGGGAGGGGAGGGAAGAGGG + Intronic
1184614570 22:45629484-45629506 AGGAAGGAAGGGAGGGAAGAGGG - Intergenic
1184766283 22:46574226-46574248 ATGAGGACACGGAGAGAAGGCGG - Intergenic
1184951420 22:47845174-47845196 ATAAGGTAATGTAGACAAGAGGG + Intergenic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1185197081 22:49478263-49478285 ATAATTTAATGGAGAGAAGATGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949284380 3:2383762-2383784 GAGAGGGAAGGGAGAGGAGAGGG - Intronic
949499861 3:4669401-4669423 ATGAGGCAAAGATGAGAAGAAGG - Intronic
949520716 3:4851404-4851426 ATGGTGGAATGGAAAGAACATGG + Intronic
949765740 3:7523814-7523836 ATGCGGGGATGGGGAGAAGAAGG + Intronic
950214849 3:11152310-11152332 ATGAGGGGTTGGGGAGCAGAAGG - Intronic
950635538 3:14311758-14311780 ATGAAGGAAGGGAGGGAGGAAGG - Intergenic
950876762 3:16282569-16282591 TTGAGAGTATGAAGAGAAGAGGG + Intronic
950924152 3:16723383-16723405 ATGAGGGCATAGTGAGAAGGTGG + Intergenic
951607275 3:24449980-24450002 AGGAAGGAAAGGAGGGAAGAAGG + Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952638773 3:35565906-35565928 ACCATGGAATGGAGAGAACATGG - Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
953263810 3:41366328-41366350 ATGAGGGAAAGTAGGTAAGATGG + Intronic
953459595 3:43072018-43072040 ATGAGTGAATGAATATAAGAAGG - Intergenic
953511154 3:43540742-43540764 AGGAGGGAATGGAGAGAGCTGGG + Intronic
953546196 3:43865240-43865262 AAGAGAGAAGGGAGAGAAGGAGG + Intergenic
954264364 3:49461323-49461345 AGGAGAGAGTGGAGAGGAGAGGG - Intergenic
954415268 3:50390394-50390416 CTGAGGGTATGAAGAGAACAGGG + Intronic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
954910186 3:54099060-54099082 ATGGGGGGATGGGGAGAAGCCGG - Intergenic
955087806 3:55720063-55720085 AAGGGGGAGGGGAGAGAAGAGGG - Intronic
955395752 3:58555981-58556003 ATGAGGGAATGGAGCTACCAGGG + Intergenic
955549625 3:60070053-60070075 GTGAGGGAATGGAGGCAATAGGG - Intronic
956157781 3:66317094-66317116 ATGGGTGAATTGACAGAAGAAGG - Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956576659 3:70759812-70759834 AGGAGGGAATTGAGAGAGAAAGG + Intergenic
956725694 3:72154905-72154927 GTGGGGGCATGGAGAGAAGCAGG - Intergenic
956725851 3:72156015-72156037 ATGGGGCAATGGGGAAAAGACGG + Intergenic
956786408 3:72646285-72646307 CTCAGGGAAGGGAGATAAGAAGG + Intergenic
956952833 3:74301971-74301993 ATGCGGGGAGGGAGAGTAGAGGG - Intronic
957360117 3:79144457-79144479 AAGAAGGAAAGGAGAGGAGAAGG - Intronic
957591463 3:82204913-82204935 ATGAGGAACTGGAAAGGAGATGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958094418 3:88924146-88924168 GTGAGGGAATAGAAAGGAGAAGG + Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958800011 3:98744348-98744370 CTCAGGGGATGCAGAGAAGAGGG - Intronic
959312219 3:104753624-104753646 ATGGGGGAAAGGATAGAAGCAGG - Intergenic
959365358 3:105451300-105451322 ATGAAGGAAGGGAGAGAGGGAGG + Intronic
959397197 3:105855263-105855285 GGGAAGAAATGGAGAGAAGAAGG + Intronic
959654669 3:108789064-108789086 TTGAGAGAATGTAGAGAAAAGGG + Intergenic
959759888 3:109948498-109948520 AGGAGGCAATGGAAAGAAAATGG + Intergenic
960008640 3:112808932-112808954 ATGATGGAAGGGAGAATAGAAGG - Intronic
960035695 3:113101073-113101095 ATGAGGAAATGGGGAGGAGGTGG - Intergenic
960255786 3:115510104-115510126 ATGTGGGAATGAAGAAACGAAGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960476340 3:118133405-118133427 AGGAGGAAAGGGAAAGAAGAAGG + Intergenic
960496552 3:118382643-118382665 AGGAAGGAAAAGAGAGAAGAAGG + Intergenic
960639102 3:119810036-119810058 GTGAGAGAATGGGGAGCAGAAGG - Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961208493 3:125107043-125107065 AAGAGGGGATGGACAGAAGGTGG - Intronic
961248872 3:125482378-125482400 ATGAGGTGAAGGAGAGGAGAAGG - Intronic
961501249 3:127337525-127337547 ATAAGGGAAGGGAGGGAAGTGGG - Intergenic
961522765 3:127476749-127476771 AAGAGGGAAGGGAGAAAAGTAGG + Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961666990 3:128498737-128498759 ATGAGGGAATGAGGACTAGAGGG + Intergenic
961726498 3:128934234-128934256 ATGAGGGAATGGTGAGACCCTGG + Intronic
962194561 3:133350289-133350311 AGGAGAGAATGGGGAGAGGATGG + Intronic
962611163 3:137077465-137077487 TGGAGGGAATGGAGAGAAATGGG - Intergenic
963249517 3:143090274-143090296 AAGAGGGAAGGGAGAGGGGAAGG - Intergenic
963306165 3:143655552-143655574 AAGAGGGTATGTAGAGGAGAAGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
963776001 3:149441147-149441169 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
964183207 3:153912735-153912757 ATGATGAAATGGAGACAAGGTGG - Intergenic
964432128 3:156618374-156618396 ATGAGGCAATTGAGAACAGACGG - Intergenic
964531370 3:157671455-157671477 AGGAAGGAAGGAAGAGAAGAAGG - Intronic
964836731 3:160947507-160947529 AAGGAGGAATGGGGAGAAGAGGG - Intronic
964870083 3:161303873-161303895 ACGAGGGCCGGGAGAGAAGAAGG - Intergenic
965202517 3:165677497-165677519 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
965211594 3:165797156-165797178 AGGAAGGAAGGGAGGGAAGAAGG - Intronic
965682525 3:171266095-171266117 AGGAGGGAAAGAAGAAAAGATGG + Intronic
965689281 3:171338201-171338223 ATGAGGCAATGAAGAGTGGAAGG - Intronic
965740083 3:171865093-171865115 ATGAAAGAATGCAGAGAAAATGG + Intronic
965800603 3:172489795-172489817 ATGGAGGAATGGGGAGATGATGG + Intergenic
965835757 3:172850370-172850392 ATTGAGAAATGGAGAGAAGAAGG + Intergenic
966093626 3:176171630-176171652 AGGAAGGAAAGGAGAGAAGGAGG + Intergenic
966270323 3:178097026-178097048 ATGAAGGGAAGGAGAGAGGAAGG + Intergenic
966273830 3:178141389-178141411 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966273888 3:178141557-178141579 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
966936485 3:184712959-184712981 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967165000 3:186772629-186772651 ATAAGGTGATGGCGAGAAGATGG + Intergenic
967222563 3:187259963-187259985 ATGAAAGAATAAAGAGAAGAAGG - Intronic
967241723 3:187446038-187446060 ATGAGAAAATTGAGAAAAGAGGG - Intergenic
967278005 3:187795401-187795423 AAGAAGGAAGGGAGGGAAGATGG + Intergenic
967418788 3:189251059-189251081 AAGAGGGAGGGAAGAGAAGAGGG - Intronic
967446878 3:189577654-189577676 AGGAGGGAAGGGAGGGAAGGAGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968937225 4:3617573-3617595 AGGAGGGAGGGGAGGGAAGAAGG - Intergenic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969242133 4:5906209-5906231 ATGTTGGCATGGAGAGAAGTGGG + Intronic
969275854 4:6135335-6135357 GTGAGGACATGGGGAGAAGACGG + Intronic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969481587 4:7449339-7449361 AGGAAGGAAAGGAGGGAAGAAGG - Intronic
969510551 4:7615130-7615152 ATGAGTGAATGGATGGCAGATGG - Intronic
969723362 4:8905539-8905561 ATGATGGAATGAAATGAAGAGGG + Intergenic
969969110 4:11027840-11027862 ATGAGGCACAGGAGAGGAGATGG - Intergenic
970104848 4:12569790-12569812 ATGAGGGACAGGGGAAAAGAGGG + Intergenic
970240824 4:14006896-14006918 ATGAGGGGAAGGAGTGAAGAGGG + Intergenic
970365044 4:15350064-15350086 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
970511817 4:16788692-16788714 ATGAATGAATGAAGACAAGAAGG + Intronic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
971045543 4:22801615-22801637 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
971070924 4:23090232-23090254 ATGAAGTAATGGAAAGAAGGAGG + Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971345641 4:25809625-25809647 AGGAGGGAAGGAAAAGAAGAAGG - Intronic
971378790 4:26077824-26077846 ATTTGGGAATTTAGAGAAGATGG + Intergenic
971392841 4:26202141-26202163 ATGAGTGAAGGTAAAGAAGAGGG - Intronic
971400289 4:26269775-26269797 TTGAGGGAAGGGAGTGAAGGGGG + Intronic
971618152 4:28820342-28820364 AGGAAGGAATGGAGGAAAGAAGG + Intergenic
971662898 4:29443002-29443024 ATGAGGTACTTGAAAGAAGAGGG + Intergenic
971781748 4:31044007-31044029 ATGAGAGAAAGGAGAGAAGATGG + Intronic
971790136 4:31159589-31159611 ATGAAAGAAAGAAGAGAAGAAGG + Intergenic
971989469 4:33872714-33872736 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
972415713 4:38838595-38838617 GTGAGGGAATGAAGAGAGGTTGG + Intronic
972727848 4:41761179-41761201 AGGAAGGAAGGGAGAGAAGGAGG + Intergenic
972960834 4:44449230-44449252 AGGAAGGAAGGAAGAGAAGAAGG - Intergenic
973043878 4:45510664-45510686 TTGAGGGAAAGGATAGCAGAAGG - Intergenic
973096870 4:46213263-46213285 GTGAGGACATGGTGAGAAGATGG + Intergenic
973114157 4:46434434-46434456 AAGAGGGAATGGGGAGACGCAGG - Intronic
973128171 4:46614913-46614935 AATAGGGAATCCAGAGAAGAAGG - Intergenic
973158053 4:46982409-46982431 ATGTGAACATGGAGAGAAGATGG + Intronic
973179051 4:47245490-47245512 GTAAGGGATTGGGGAGAAGAAGG + Intronic
973238187 4:47928714-47928736 ATGAGGAAATGGAAAGTATAAGG + Intronic
973721002 4:53723692-53723714 AGGAGGGAGTGCAGAGAAGTCGG - Intronic
973833772 4:54789098-54789120 AGGAGGGGAAGGAGAGAGGAGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974308584 4:60174520-60174542 CTGAGAGGATGGAGAGATGATGG - Intergenic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
974525055 4:63040434-63040456 GTGAGGGAAGGAAGAGAGGAAGG - Intergenic
975044439 4:69783836-69783858 AGGAGAGGATGGAGAGAGGATGG + Intronic
975226250 4:71876262-71876284 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
975268761 4:72403942-72403964 TTGAGTCAATGGAGAGAAAAGGG + Intronic
975499994 4:75074051-75074073 AGGAGGAAAAGGAGAGAAGTAGG - Intergenic
976019732 4:80607001-80607023 AGGAAGGAAGGGAGAGAGGAAGG + Intronic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976158375 4:82172351-82172373 ATTGGGGATTGGGGAGAAGAAGG - Intergenic
976836409 4:89379834-89379856 ATGAGGGAGTGGTCAGCAGAAGG - Intergenic
976880659 4:89920886-89920908 GTGAGGGAGTGGAAAGAACATGG + Intronic
976954394 4:90877683-90877705 ATTAAGGAATGGAGAATAGAAGG + Intronic
977245150 4:94622661-94622683 AGGAGGGAAAGGTGAGAAGGAGG - Intronic
977531606 4:98207133-98207155 AGGAGGGTTTTGAGAGAAGATGG + Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
977992973 4:103466843-103466865 TTGAGGGAAAGGAGAAAGGAAGG + Intergenic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978340347 4:107715917-107715939 ATGAGGATATTGAGAGATGAAGG + Intronic
978625399 4:110679708-110679730 AAAAGGGAATGGAGAGAGGAAGG - Intergenic
978689647 4:111491111-111491133 ATGAAGGAATGAAGAAAATAAGG - Intergenic
978697231 4:111596866-111596888 ATGAGGAAAGTGAGAGATGACGG + Intergenic
979036624 4:115727708-115727730 ATGAGAGAGTGCAGAAAAGATGG - Intergenic
979284397 4:118905277-118905299 AGCAGTGAATAGAGAGAAGAAGG - Intronic
979413989 4:120413648-120413670 ACGGGGGACTGGAGAGAAGGTGG + Intergenic
979769246 4:124502209-124502231 AAGAAGGAATGGAGAAAGGAAGG + Intergenic
979841241 4:125443393-125443415 CTGAGGGAATGTAGTGAAGACGG - Intronic
980091689 4:128449481-128449503 AAGAGGAAATGTAGAGAAGAGGG + Intergenic
980577291 4:134699479-134699501 AGGAAGGAATCCAGAGAAGAAGG + Intergenic
980670010 4:135993438-135993460 ATAAGTGGATGGAAAGAAGAAGG - Intergenic
981113744 4:140965750-140965772 GTGGGGGAGTGGAGAGAAAATGG + Intronic
981262771 4:142741821-142741843 AAGAGAGAATGGAGAGACCAGGG + Intronic
981732167 4:147911018-147911040 ATGAGGAAAGGGAAAGAAAAGGG - Intronic
982044946 4:151435248-151435270 AGGAGAGAATGAAGAGAAGTTGG - Intronic
982232471 4:153221977-153221999 AGGAAGGAAGGGAGAGAGGAAGG + Intronic
982343862 4:154334213-154334235 TTGAGGGAAGGGAGAGAGGAAGG + Intronic
982358877 4:154497317-154497339 TGGAGGGAATGGGGAGAAGTTGG - Intergenic
982524722 4:156463892-156463914 ATGAGGAAATAGAAAGAAAAGGG - Intergenic
982805946 4:159762648-159762670 ATTAGGGAGTGGAGTGGAGACGG - Intergenic
982972050 4:162000879-162000901 AAGAAGGGATGGAGGGAAGAGGG + Intronic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
983286523 4:165746910-165746932 ATGAGGCAAATGAGGGAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983824790 4:172245737-172245759 ATTAGGTAATGGAGCCAAGAAGG - Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984179564 4:176464958-176464980 AAGAGGGAACAGAGAAAAGAGGG - Intergenic
984646737 4:182228083-182228105 AGGAGGAAATGGAGAGATGTGGG + Intronic
984908798 4:184652910-184652932 AGGAGGGAAGGGAGAAAGGAAGG + Intronic
985486857 5:156671-156693 ATGAGGGAATGGAAAGAGCAGGG + Intronic
985671624 5:1209757-1209779 ATAGGGGAAGAGAGAGAAGAGGG - Intronic
986367178 5:7043999-7044021 ACCAGGCAAGGGAGAGAAGAGGG - Intergenic
986677139 5:10195998-10196020 GTGAGGACATGGTGAGAAGACGG - Intergenic
986793716 5:11189178-11189200 ATGGAGGAAGGGAGAAAAGAAGG - Intronic
987650667 5:20736442-20736464 AAGAGGTGATGGAGAGAGGAAGG - Intergenic
987879531 5:23725030-23725052 AGGAAGAAATGGAGAGAAGGGGG - Intergenic
987910142 5:24132411-24132433 AGGAGGGGAGGGGGAGAAGAAGG + Intronic
988156097 5:27450820-27450842 AGGAGGAAATGGAGAGAAGTAGG + Intergenic
988296988 5:29378030-29378052 ATGAGGGAATGTATACATGATGG + Intergenic
988403668 5:30796214-30796236 AGGAGGGAATGGGGAGATGATGG + Intergenic
988737485 5:34037295-34037317 ATGAAGCAAAGGAGAGAAAAAGG + Intronic
988785021 5:34558491-34558513 AAGAGAGGAAGGAGAGAAGAAGG + Intergenic
988837137 5:35044647-35044669 ATGAAGGAATGGAGGGAAGGAGG - Intronic
989273506 5:39559323-39559345 AGGAGGAAAAGGACAGAAGATGG - Intergenic
989352415 5:40501359-40501381 AGGAGGGATTGGAGAAAAGTAGG - Intergenic
989992455 5:50783167-50783189 AGGAGGGAAAAGAGAGAAGAGGG + Intronic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990313072 5:54558369-54558391 ATGATGGAATGGAGAGAGGGAGG - Intergenic
990532121 5:56684516-56684538 ATGAGGGGATGGAGAGAATGTGG - Intergenic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
991260970 5:64667657-64667679 ATGAAGGAAGGGAGAAAAGAAGG + Intergenic
991439270 5:66629420-66629442 AGCAGGGAATGGAAAGAAAAAGG - Intronic
991650502 5:68847739-68847761 ATGAGGGCAGACAGAGAAGAGGG + Intergenic
992116246 5:73540906-73540928 AAGAGGGAAGGAGGAGAAGAGGG + Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992656198 5:78912218-78912240 ATAAGGAAAAAGAGAGAAGATGG + Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993159360 5:84269032-84269054 ATGAGGGAACAAAAAGAAGAGGG - Intronic
993240445 5:85377273-85377295 TTGAGGAATTGGAGAGATGATGG - Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
994003601 5:94811172-94811194 AAGATGGAATGGAGTAAAGAAGG - Intronic
994190394 5:96862779-96862801 ATGAGGCAATTGAGAGATTAAGG + Intronic
994287784 5:97991310-97991332 AGGAGGGGGTGGAGAAAAGAAGG + Intergenic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
994734176 5:103532097-103532119 ATCAGAGATTGGGGAGAAGAAGG + Intergenic
994753855 5:103770847-103770869 ATGAGAGAAAGAAGAGAAGAGGG + Intergenic
994842311 5:104941220-104941242 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
995133368 5:108654355-108654377 AGAAGGGAATAGAGAGAAGTTGG + Intergenic
995390059 5:111630479-111630501 AAGGGGGGATGGAGAGAAAAAGG + Intergenic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
995837071 5:116409624-116409646 ATGAAGGCATAGGGAGAAGATGG + Intronic
996053778 5:118962638-118962660 AAGAGGGAATGAAAAGGAGAAGG + Intronic
996167418 5:120242311-120242333 AGGAAGGAAAGGAGGGAAGATGG - Intergenic
996339006 5:122415568-122415590 AGTTGGAAATGGAGAGAAGAGGG + Intronic
996988714 5:129601839-129601861 AGGAGGGAATGGAGACTTGAAGG - Intronic
997577654 5:134994986-134995008 ATGAAGGAAGGGAGGGAGGAAGG - Intronic
997677797 5:135726464-135726486 AAGAAGGAATGGAGGCAAGAGGG - Intergenic
997998328 5:138604337-138604359 GTGAGGGAAAGAAGAGAGGAAGG + Intergenic
998155609 5:139785213-139785235 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
998164501 5:139835271-139835293 ATGGGTGAATGAATAGAAGATGG - Intronic
998198832 5:140101249-140101271 GTGGGGGAAAGGAGAGGAGAAGG + Intergenic
998203481 5:140143539-140143561 GTGAGGGAAGGAGGAGAAGAGGG - Intergenic
998209470 5:140183397-140183419 AAGTGAGAATGGAGAGAAAATGG - Intronic
998300559 5:141015245-141015267 AAGAGAGAATTGAAAGAAGATGG - Intergenic
998593200 5:143499765-143499787 ATGAGGAAATGGAGGCAAAAAGG + Intergenic
998638919 5:143987484-143987506 AGGAGGGAATGGAGGGAATGAGG - Intergenic
998781330 5:145659889-145659911 ATGTGGGAAGGGATAGAAAAGGG + Intronic
998984638 5:147742608-147742630 ATAAGGGAATAGAGAGATGGGGG + Intronic
999236858 5:150103790-150103812 GTGAAGGAATGGAGTGGAGATGG + Intronic
999335845 5:150715852-150715874 ATGAGGAACTGGGGAGAACATGG + Intronic
999343817 5:150797208-150797230 AGGAGGGGAAGGAGAGTAGAAGG + Intergenic
999672981 5:153973917-153973939 ATGAGGACATGGAAGGAAGAGGG - Intergenic
999701874 5:154235597-154235619 ATGACGGAATGTCCAGAAGAAGG - Intronic
1000047673 5:157535014-157535036 ATGAGGAAACTGAGAGGAGAAGG - Intronic
1000109681 5:158095943-158095965 GTGGGGGAGTGGAAAGAAGATGG + Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000263864 5:159616247-159616269 ATGAGTGAGTGGAAAGAATAAGG - Intergenic
1000676677 5:164130321-164130343 AAGAAGGAAGGAAGAGAAGAGGG - Intergenic
1000800012 5:165714113-165714135 ACGAGGTAAGGGAGAGAGGAAGG - Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1001010952 5:168097864-168097886 ATGAGTGAAGGAAGAGAATAGGG - Intronic
1001151631 5:169233801-169233823 AGGAAGGAAGGGAGAGAAAAGGG - Intronic
1001200997 5:169716669-169716691 TGGAGGAAATGGGGAGAAGAAGG - Intronic
1001498244 5:172205922-172205944 ATGGGGGCAGGGAGAAAAGATGG + Intergenic
1001583354 5:172815740-172815762 AAAAGGGAAGCGAGAGAAGATGG + Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001762015 5:174215300-174215322 ATGAGAGAATGCACAGAAGCGGG + Intronic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002102360 5:176863791-176863813 AGGAGGGGAAGGAGGGAAGAAGG - Intronic
1002172506 5:177383390-177383412 ACGGGGGAATGGAGAGAAACAGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002453198 5:179331276-179331298 AAGGGAGAATGGAGAGAAAAGGG + Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1002807122 6:587963-587985 GTGAGGGAGGGGAGAGAAGCAGG + Intronic
1002854908 6:1027784-1027806 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1003224222 6:4189985-4190007 AGGAGAGAATGAAGAGGAGAGGG + Intergenic
1003385752 6:5665945-5665967 ATGAGGGTTTGGAGAGGAGGTGG + Intronic
1003545706 6:7056598-7056620 ACGAGGGAAGGGAGAGGGGAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003611122 6:7615875-7615897 ATGAGTCAATAGAGAGATGACGG - Intergenic
1003734453 6:8862748-8862770 ATGAGGGAAATGAGAGAACATGG + Intergenic
1003754409 6:9100556-9100578 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003942115 6:11039900-11039922 AGGAAGGAATGGAGAGAATGTGG + Intronic
1003994058 6:11520335-11520357 TTGAGGGAATAGATAAAAGAGGG - Intergenic
1004271248 6:14197685-14197707 ATGAGTGAAAGCAGAGGAGATGG + Intergenic
1004286157 6:14322745-14322767 TTGAGGGACAGGAGAGCAGAGGG + Intergenic
1004380521 6:15128537-15128559 ATGAGGGGCTGGAGACAGGAAGG - Intergenic
1004407437 6:15347218-15347240 ATGAGGATATGGGGAAAAGAAGG + Intronic
1004751289 6:18565404-18565426 AAGAAGGAAGGGAGAGAAGGAGG - Intergenic
1005091999 6:22066952-22066974 AGGAAAGGATGGAGAGAAGAAGG - Intergenic
1005224276 6:23623294-23623316 AGGAGGGAAGGAAGAGAGGAAGG + Intergenic
1005224283 6:23623322-23623344 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1005224302 6:23623398-23623420 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1005224332 6:23623506-23623528 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1005441898 6:25878959-25878981 AGGAAGGAAAGGAGAGAAGGAGG - Intronic
1005584552 6:27263054-27263076 AGGAGGGAATGCATACAAGAAGG + Intergenic
1005604555 6:27462882-27462904 ATCAGGCAATGCAGAGAAGCAGG + Intronic
1005784958 6:29235523-29235545 ATAAGGGATTGTAGAGAACAAGG + Intergenic
1005813732 6:29534030-29534052 ATGAGGGAAGCAAGAGAAGAAGG - Intergenic
1005872223 6:29983119-29983141 AATAGGAAATGGAGAGAGGAAGG - Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1006335099 6:33416254-33416276 ATGAAGGAGGGTAGAGAAGAGGG - Exonic
1006486805 6:34349533-34349555 ATGTGGGACTGGAGTTAAGAGGG + Intronic
1006673642 6:35746368-35746390 ATGAGGGAGAGAAGAGAAGATGG + Intronic
1006802278 6:36766807-36766829 ATGATGAAGTGGAGAGAAGGAGG - Intronic
1006905333 6:37529490-37529512 ATGAAGGAATGGAGTGATGAAGG - Intergenic
1007019735 6:38507487-38507509 TGGATGGTATGGAGAGAAGAGGG - Intronic
1007138759 6:39549960-39549982 ATGAGGGAAGGGAGAGAGGGAGG + Intronic
1007248562 6:40480169-40480191 ATGAGGAAATGGAGGCCAGATGG + Intronic
1007292302 6:40797044-40797066 AGGAGGGGAGGGAGAGAAGCTGG - Intergenic
1007296068 6:40821531-40821553 AAGAGGGAATGGAAAGGCGAGGG + Intergenic
1007432641 6:41785634-41785656 ATCAGGGAGTGGGGAGAAGTAGG + Intronic
1007567120 6:42860078-42860100 GTGAGGGAATGCAGTGTAGAAGG + Intronic
1007656460 6:43454111-43454133 ATGAGGAAATGGAAAGATAAAGG - Intronic
1007993130 6:46278095-46278117 AAGAGGGAATGGATAGAAATGGG - Intronic
1008202859 6:48614068-48614090 CTGAGGGAATGGAGAGGTTATGG - Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008457263 6:51725497-51725519 AAGAGGAAATGCAAAGAAGAAGG + Intronic
1008497209 6:52145475-52145497 AGGAGGAAAGGGAGGGAAGAAGG + Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1008541375 6:52549242-52549264 AGGAGGGAAGGGAGGGAAGGAGG - Intronic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1009243110 6:61203266-61203288 AGGAGGGAAGGGAGGGAAGGAGG + Intergenic
1009428534 6:63541012-63541034 AGGAGGGAATGAAGAAAGGAAGG + Intronic
1009731397 6:67612567-67612589 GTGAGGGAATGAAAAGAACAAGG - Intergenic
1010177840 6:73050301-73050323 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1010181985 6:73097213-73097235 TTGGGGGAATGGGGAGATGATGG - Intronic
1010557102 6:77296004-77296026 AGGAGACAATGGAGAGAAGTTGG - Intergenic
1010769192 6:79809073-79809095 GTGAGAGAATAGAGAGGAGAGGG + Intergenic
1010804426 6:80218187-80218209 ATGAGGGAATGGACTGAGCAAGG - Intronic
1011027077 6:82880934-82880956 GTGAGGGAAAGAAGACAAGAGGG + Intergenic
1011618090 6:89216402-89216424 ATGAGGAAATGGAGACAGTAGGG - Intronic
1011781903 6:90799045-90799067 ATGGTGGAATGGAAAGAAAATGG - Intergenic
1011865907 6:91826618-91826640 TAGAGGGAACAGAGAGAAGATGG - Intergenic
1011913366 6:92470065-92470087 ATTGGGGAATGCAGGGAAGATGG + Intergenic
1012289108 6:97429200-97429222 AAGTGGGAGTGTAGAGAAGACGG + Intergenic
1012473921 6:99601237-99601259 ATGAGGGCAAGGGGAAAAGAGGG - Intergenic
1012498943 6:99867243-99867265 ATGAGGAACTTGACAGAAGAGGG - Intergenic
1012569318 6:100702211-100702233 AGGAGGGAATGGAGAGAAATGGG + Intronic
1012620069 6:101333117-101333139 CTAAAGGAATGCAGAGAAGAAGG - Intergenic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012801470 6:103834554-103834576 AGGAGGGACTGGGGAGATGATGG - Intergenic
1012846172 6:104392320-104392342 AGGGGGGAATGGGGAGATGATGG + Intergenic
1012989129 6:105907096-105907118 ATGAGGAAATGAGGAGAGGAGGG - Intergenic
1013209706 6:107975381-107975403 GTTATGGAATGGGGAGAAGATGG + Intergenic
1013281782 6:108644600-108644622 ATGAGGGCAGGTAGAGAACAGGG - Intronic
1013647024 6:112154950-112154972 ACAAAGGAATTGAGAGAAGAGGG + Intronic
1013724741 6:113080133-113080155 GGGAGGGAAGAGAGAGAAGAAGG + Intergenic
1013745712 6:113343817-113343839 ATAAGGGAATGGAGATGATACGG + Intergenic
1013786446 6:113786957-113786979 TTGAGGGAATGGGGAGATGTTGG - Intergenic
1014052362 6:116969498-116969520 TTGATGGAATGGGGAGAACAAGG + Intergenic
1014287406 6:119515964-119515986 AGAATGGAAGGGAGAGAAGAAGG - Intergenic
1014497005 6:122137719-122137741 AAGAGGGTATGGTGAGAGGATGG - Intergenic
1014554003 6:122823407-122823429 CTGAGGTAATGGAAAAAAGATGG - Intergenic
1014646717 6:123982925-123982947 AATAGGGAATGGAGAGAGAAGGG - Intronic
1014677013 6:124379207-124379229 GGGAGGGAAAGGAGGGAAGAGGG + Intronic
1014719688 6:124901025-124901047 ATGAGCAAATGGAAAGAAGATGG - Intergenic
1014748457 6:125228211-125228233 TTGGGGGAAAGGAAAGAAGAGGG + Intronic
1014762700 6:125375145-125375167 AGGAATGAATGGAGAGAAAAAGG - Intergenic
1014762714 6:125375236-125375258 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1014804906 6:125818542-125818564 AGAGGAGAATGGAGAGAAGAGGG + Intronic
1015416795 6:132958201-132958223 AGGAAGAAAAGGAGAGAAGAAGG + Intergenic
1015478415 6:133679580-133679602 AAGAGGGAAGAGAGAGAAGGAGG + Intergenic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015507740 6:134007005-134007027 ATGAGGGCAGGGAGAGATCAGGG - Intronic
1015747787 6:136529007-136529029 AAAAGGGAATTGCGAGAAGATGG - Intronic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1015890658 6:137966943-137966965 ACGAGGGAATGGGAAGGAGAAGG + Intergenic
1016101369 6:140105335-140105357 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1016183313 6:141173080-141173102 AAGAAGGAATGGGGAGGAGACGG + Intergenic
1016402335 6:143694096-143694118 AAGAAGGAAGGGAGGGAAGAAGG + Intronic
1016455978 6:144231208-144231230 AAGAGAGGATGGTGAGAAGAGGG + Intergenic
1016800499 6:148164126-148164148 ATCAGGGATTGGAGAAAAGTAGG - Intergenic
1016804967 6:148203373-148203395 AGGAAGGGAGGGAGAGAAGACGG - Intergenic
1017218447 6:151937388-151937410 TTGAGTGATTGGAAAGAAGACGG + Intronic
1017511968 6:155122419-155122441 AGGAGGGAATGGAGAATGGAAGG + Intronic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017617941 6:156265062-156265084 ATCAGTCATTGGAGAGAAGATGG - Intergenic
1017728755 6:157295783-157295805 ATGAGGGAAAGGAACGGAGATGG + Intronic
1017734034 6:157344543-157344565 AGGAGGGATTGGAGAGACGTTGG - Intergenic
1017854812 6:158341062-158341084 AGGAGGGAATAAAGAGAACATGG - Intronic
1018352523 6:162975761-162975783 AAGAAGGGAGGGAGAGAAGAAGG - Intronic
1018432496 6:163733548-163733570 ATGAGGGAATGAACAGGAGTTGG - Intergenic
1018710562 6:166495594-166495616 ATGAGGGAGTGAAGACAACAGGG - Intronic
1018839710 6:167508574-167508596 GAGAGGGAATGGGGAGGAGAAGG - Intergenic
1018847106 6:167563449-167563471 ATGAGGGAATGCATAGGTGAGGG - Intergenic
1018847161 6:167563657-167563679 ATGAGGGAATGCATGGATGAAGG - Intergenic
1019103445 6:169650237-169650259 ATGGGGGGATGCAGAGATGAGGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019264595 7:106792-106814 TGGAGGGAATGAAGAGAAGGTGG + Intergenic
1019646554 7:2132769-2132791 ATGGGTGAATGGATAAAAGATGG - Intronic
1019671215 7:2280043-2280065 AGGAGGGAGGGGAGAGAAGAAGG + Intronic
1020048154 7:5059299-5059321 ATGAAGGAAGGGAGAGAGGGAGG - Intronic
1020509345 7:9033742-9033764 ATGAGGGAAGGGAGACAAAGAGG - Intergenic
1020604550 7:10320031-10320053 ATGAGGAAATGGAGGGAGGGAGG - Intergenic
1020837769 7:13175867-13175889 ATGGTGGATTGAAGAGAAGAGGG + Intergenic
1020840360 7:13210064-13210086 ATGAGGGAATGAGGAGATAATGG - Intergenic
1020874731 7:13678285-13678307 ATGAGGGGGTGGAGCCAAGATGG - Intergenic
1020885703 7:13816848-13816870 ATCAGGGGAAGGAGAGAAGAGGG - Intergenic
1021090461 7:16477184-16477206 ATAAAGGAATGGAGAAAACAGGG - Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1022004349 7:26253799-26253821 AGGAAGGAAAGGAGAGGAGAAGG + Intergenic
1022254799 7:28645158-28645180 TTGAGGCAATGGAAAGATGATGG + Intronic
1022351797 7:29573111-29573133 TTGAGGGGTTGGAGAGAAAAGGG - Intergenic
1022633400 7:32107341-32107363 AAGAAGGAAGGGAGAGAAGGAGG + Intronic
1022747452 7:33187525-33187547 ATGAGGGGATGGACAGACGGAGG - Intronic
1022955268 7:35374697-35374719 AAGAGGGAATTGGGAGTAGAAGG - Intergenic
1023191022 7:37583218-37583240 ATGAGGCAATGAAAAGAAAATGG + Intergenic
1023236515 7:38095795-38095817 AAGAGGGCAAGGAGAGGAGATGG + Intergenic
1023280328 7:38562663-38562685 AAGAGGGGAGGGAGAGGAGAGGG + Intronic
1023371749 7:39518849-39518871 ATGAGACAAGGGAGAGAAGAAGG - Intergenic
1023449274 7:40265469-40265491 ATGAGGGAAGGAAGAAAAGAAGG - Intronic
1023781900 7:43663722-43663744 ATGGGGAAATGGAGAGTTGATGG - Intronic
1023867673 7:44245981-44246003 AGGAAGGAAGGGAGAGAGGAAGG + Intronic
1024229910 7:47355870-47355892 ATGAGGGAGGGGAAGGAAGATGG + Intronic
1024268246 7:47622768-47622790 GGGAGGGAATGGAGACAGGAAGG - Intergenic
1024294098 7:47829059-47829081 ATGAAGGCAGGGAGAGAGGAAGG + Intronic
1024428472 7:49258037-49258059 ATGAGGAAAATGAGAGAAAAGGG + Intergenic
1024446402 7:49484547-49484569 ATGAGTGAATACAGGGAAGACGG + Intergenic
1024800559 7:53073045-53073067 ATAAGGTAGTGGAGAGAAAATGG + Intergenic
1024836676 7:53528416-53528438 AGGAGGGAATGAAGAGCAAATGG - Intergenic
1024840691 7:53583805-53583827 ATGAGAGAATGGAGATAGCAGGG - Intergenic
1025072441 7:55912216-55912238 ATGAGGCGATGGAGAGCACATGG - Intronic
1025299349 7:57805739-57805761 AGGAGGGAATGCAGGGAGGAAGG - Intergenic
1025321606 7:58100272-58100294 ATGAGGGAAGGAAGGGAAGGAGG + Intergenic
1026137774 7:67678551-67678573 TTGAAGGCAGGGAGAGAAGAGGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026306908 7:69150364-69150386 AGGAGGGAAGGGAGAAAAGGTGG - Intergenic
1027200192 7:76059393-76059415 ATGAGGAAATGGGGACAACAGGG - Intronic
1027261507 7:76468057-76468079 CGGGGGGAATGGAGAGAGGAGGG + Intronic
1027541939 7:79477778-79477800 AAGAGGGAAGGAAGAGATGATGG + Intergenic
1027837865 7:83268897-83268919 ATGAAAAAATGTAGAGAAGAAGG - Intergenic
1028454722 7:91026637-91026659 GTGAGGGAGGGGAGAGACGATGG - Intronic
1028464017 7:91128883-91128905 ATTAGTTAATGGAGAGGAGATGG - Intronic
1028618832 7:92801629-92801651 AAGAGAGAAGGGAGGGAAGAAGG - Intronic
1028722438 7:94049002-94049024 ATGAGGACATAGAGAGTAGAAGG + Intergenic
1028753530 7:94409539-94409561 ATGAGGAAAAGGAAAGGAGAAGG - Intronic
1028787514 7:94812670-94812692 AGGAGAGAATGAAGAGAAGTGGG + Intergenic
1028960768 7:96747770-96747792 AGGAAGGAAGGGAGAAAAGAAGG - Intergenic
1028985482 7:97005699-97005721 AGGAGGGATGGGAGAGGAGAGGG - Exonic
1029007645 7:97227252-97227274 ACTGGGGAATGGAGAGAATATGG + Intergenic
1029048363 7:97656076-97656098 CTGAGGGATATGAGAGAAGATGG - Intergenic
1029359191 7:100075882-100075904 AAGAGTGACTGGAGAGAAGAGGG - Intronic
1029473202 7:100767391-100767413 AGGAGGGAGTCCAGAGAAGAGGG - Intronic
1029538834 7:101171477-101171499 ATGAGGGGCTAGAGAGAAGTGGG + Exonic
1029628861 7:101737789-101737811 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1029971303 7:104792132-104792154 GTGAGGGAAAGGAGAGAAAGTGG - Intronic
1030261148 7:107565208-107565230 ATGAGAGCATGCAGAGTAGAGGG - Intronic
1030396431 7:108992384-108992406 ATGAGGTAAGGGAGAGAAGTGGG + Intergenic
1030455453 7:109767118-109767140 ATGGGTGAATGGACAGAAGTAGG + Intergenic
1030916730 7:115323901-115323923 ATGATGGAAAGAAGAAAAGAGGG + Intergenic
1031122885 7:117741203-117741225 ATGGGGGAATGGAGAGCAGGAGG + Intronic
1031484449 7:122310754-122310776 CTGCGGGAATGCAGAGGAGAAGG - Intergenic
1031500440 7:122507870-122507892 ATGAGGGTAAGGAAAAAAGAGGG + Intronic
1031658100 7:124383380-124383402 ATGAGTCAATGAAGAGAAAAAGG + Intergenic
1031664467 7:124467715-124467737 TTGAACGAATTGAGAGAAGAAGG - Intergenic
1031757643 7:125665873-125665895 ATGAGGTAGTAGAGAGAAGGTGG + Intergenic
1031989285 7:128186455-128186477 TTGAGGGAAGGAAGAGAAGAAGG - Intergenic
1032661378 7:133987482-133987504 AAGCGGGGAGGGAGAGAAGAAGG + Intronic
1032663464 7:134011630-134011652 ATGAAGGAATGAAGAAATGAAGG - Intronic
1032818450 7:135501440-135501462 ATGAGGGACTAAAGAGAAGATGG + Intronic
1032918381 7:136517916-136517938 AGGAGAAAAAGGAGAGAAGAGGG - Intergenic
1033014715 7:137660857-137660879 AGGAGAGAAGGGAGAGGAGAGGG + Intronic
1033444965 7:141412640-141412662 ATGAGGGAAGGAAAAGAAAATGG + Intronic
1033609849 7:142954536-142954558 AAGAGAGACTGGAGAGAAGCAGG + Intronic
1033665296 7:143435562-143435584 AAGAGGGAAGAGAGAGAAGGAGG - Intergenic
1033765082 7:144480527-144480549 ATTAGGGAATGGAGTGTAGAGGG + Intronic
1033866102 7:145692147-145692169 AAGAGGGAAAGGAAAAAAGAAGG - Intergenic
1033910092 7:146252538-146252560 ATGAGAAAATAGAGAGAGGATGG + Intronic
1034442686 7:151094821-151094843 AGGAGGGAAGGGAGGGAGGAAGG - Intronic
1034679208 7:152915817-152915839 ATGAGGGGAGGGGGAGGAGAAGG - Intergenic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1034889727 7:154829387-154829409 AAAAAGGAAAGGAGAGAAGAGGG + Intronic
1034902253 7:154914864-154914886 GTGAGGGCACGGGGAGAAGACGG - Intergenic
1035578704 8:725847-725869 ACGAAGGAGGGGAGAGAAGAAGG - Intronic
1035652454 8:1278649-1278671 ATTAGGTAAGGTAGAGAAGAAGG - Intergenic
1035690720 8:1557732-1557754 ATGAGGACATGGGGAGAGGACGG - Intronic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036546120 8:9771456-9771478 AAGAAGGGAGGGAGAGAAGAAGG + Intronic
1036595518 8:10208560-10208582 AGGAAAGAATGGAGAAAAGAAGG - Intronic
1036678723 8:10854977-10854999 AAAAGGGAATGGAGAGAACAGGG + Intergenic
1037071740 8:14658911-14658933 AGGAGGGAAGGGAGACAGGAAGG + Intronic
1037246998 8:16846357-16846379 ATCAGGAAAAGGAGAGAACATGG - Intergenic
1037249012 8:16871112-16871134 ATGAGGCTAGGGAGAGAGGAAGG + Intergenic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037552472 8:19988222-19988244 ATGAGGGAAAGAGGAGAAGAGGG + Intergenic
1037673784 8:21037399-21037421 GGCAGGGAAAGGAGAGAAGAGGG + Intergenic
1037681701 8:21103002-21103024 ATGAAGGGATAGAGAGAAAATGG + Intergenic
1038018324 8:23533013-23533035 GTGAGGGAGAGGAGACAAGAAGG - Intronic
1038219196 8:25591672-25591694 ATGAAGGAAGGAAGGGAAGAAGG - Intergenic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1039177753 8:34828386-34828408 ATTAAGGGATGGAGAGAAGTTGG + Intergenic
1039320096 8:36420045-36420067 ATGAGTTGAGGGAGAGAAGAAGG + Intergenic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039396670 8:37231672-37231694 GTGAGAGAAAGGAGAGAGGAAGG + Intergenic
1039809017 8:41028034-41028056 ATGAGAGAATGGAGTAATGAAGG - Intergenic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040675887 8:49749643-49749665 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1040864211 8:52032002-52032024 ATGAGGGATTCTAGGGAAGAAGG - Intergenic
1040903569 8:52441698-52441720 AGGAAGGAAGGGAGAGAAGGAGG + Intronic
1040937226 8:52794424-52794446 ATGAAGAAATGGAGACCAGAAGG + Intergenic
1041342294 8:56858651-56858673 GTAAGGAAATGGAGAGGAGAGGG - Intergenic
1041433754 8:57815508-57815530 ATGAGGAAATGGAGGTATGAAGG + Intergenic
1041469336 8:58191358-58191380 AAGAGGGAACACAGAGAAGATGG + Intronic
1041616842 8:59917007-59917029 ATATGGGAATTGAAAGAAGATGG + Intergenic
1041769155 8:61454316-61454338 AGGGGGGAAAGGAGAGAGGAGGG - Intronic
1042103669 8:65300907-65300929 ATGAAGTCATGGGGAGAAGATGG - Intergenic
1042421003 8:68589550-68589572 ATGAAGGAAGGGAGAGAGAAAGG + Intronic
1043073003 8:75662826-75662848 AGGAGGGAAGGGAGAGAGGGAGG + Intergenic
1043319698 8:78968691-78968713 AGGAGGGAAGGGAGAAAAGCGGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043754121 8:83980748-83980770 AGGAGGAAATGGAAAGAAAAGGG + Intergenic
1043788177 8:84428791-84428813 ATTAGGAAATGTAGAGTAGAGGG - Intronic
1043913523 8:85893068-85893090 AGGAAGGAAAGGAGAGAATAAGG + Intergenic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1044054228 8:87548438-87548460 ATGGGGGAATGAACAGAAGTGGG + Intronic
1044471297 8:92571893-92571915 ATGAGGTATTGGAGAGGAAATGG - Intergenic
1044526397 8:93256542-93256564 AGGAGGATATGAAGAGAAGATGG + Intergenic
1044589552 8:93900549-93900571 ATGAAGGAAAGGAAAGCAGAGGG - Intronic
1044778162 8:95715541-95715563 AGGAGGGAAGGGAGAGAGGGAGG - Intergenic
1044835415 8:96290721-96290743 ATGAAGGAGTGGAGAGAGTAGGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045047169 8:98290467-98290489 TAGAGAGAATGGACAGAAGAGGG - Intronic
1045305191 8:100951840-100951862 ATGAGGGGACGGAGCGAGGACGG + Intronic
1045611317 8:103846345-103846367 GTAAGGGAATGGAGTGAAGCAGG + Intronic
1045743445 8:105388304-105388326 AAGAAGAAATGGAGAGAAAAGGG + Intronic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1047139421 8:122120261-122120283 AATAGGGAAAGGACAGAAGAAGG + Intergenic
1047306855 8:123659457-123659479 ATGAGTGGATGGATAGATGATGG - Intergenic
1047622534 8:126622574-126622596 ATTAGGGAAGGGAGAAAATAAGG - Intergenic
1047650697 8:126917033-126917055 AAGATGGAAGGGAGAGAAAAGGG - Intergenic
1047674926 8:127190884-127190906 AGGAAAGAATGAAGAGAAGAAGG + Intergenic
1047846204 8:128808084-128808106 ATGAGGTAACAGTGAGAAGAAGG + Intergenic
1047878047 8:129162103-129162125 ATGATGAGATGGAGAGATGATGG + Intergenic
1048100139 8:131342194-131342216 AAGAGGGTAGGGAGAGTAGAGGG - Intergenic
1048117332 8:131539402-131539424 ATATGGGAATGTAGAGAGGATGG - Intergenic
1048282014 8:133112592-133112614 GTGAGGGAAGGGAGAGAAAAGGG + Intronic
1048296966 8:133221512-133221534 ATGAGTGGATGGATAGATGACGG + Intronic
1048323456 8:133420438-133420460 ACTAGGTGATGGAGAGAAGATGG - Intergenic
1048363136 8:133715241-133715263 GGGAGGGAAAGGAGAGAAGACGG - Intergenic
1048376828 8:133830141-133830163 ATAAGGGAAAGAAGAAAAGAAGG + Intergenic
1048457056 8:134587741-134587763 ATGAGGGAATGGAGAGAAGAAGG - Intronic
1048513271 8:135081159-135081181 ATGAGGGAAAGGAGGGAAAGGGG + Intergenic
1048584771 8:135764762-135764784 ATCAGAGAATGGAAAGAAGAGGG + Intergenic
1048931587 8:139319540-139319562 TTGAACGAATGGAGAGAACAAGG + Intergenic
1049155279 8:141062482-141062504 ATGACTGGATGGAGAGAGGATGG + Intergenic
1049361164 8:142213115-142213137 AGGAAGGATTGGAGAGAAGGTGG - Intronic
1049501523 8:142970269-142970291 AGGAAGGGATGGAGAAAAGAGGG + Intergenic
1049998678 9:1053227-1053249 ATAGGGGAATGAAGAGATGAGGG - Intronic
1050006093 9:1132194-1132216 ATGGGGGAATGGGTAGATGATGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050249616 9:3730975-3730997 ATTAGGAAATGAAGTGAAGAGGG - Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051099324 9:13502902-13502924 ATGGGGAAAGGGAGAGAAGCAGG - Intergenic
1051352411 9:16210217-16210239 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1051394719 9:16607337-16607359 ATTAGGGAATGTAGAAAAAAAGG + Intronic
1051446578 9:17146271-17146293 AAGAGAGAAAAGAGAGAAGAAGG - Intronic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051870427 9:21731061-21731083 ATGCAGGAATGGAGAGAAAATGG - Intergenic
1051968340 9:22857153-22857175 GTGGAAGAATGGAGAGAAGAGGG - Intergenic
1052209314 9:25882896-25882918 GTGAGGAAATGGGGAGAAGTAGG - Intergenic
1052291993 9:26852473-26852495 AAAAGGGTATTGAGAGAAGAGGG + Intronic
1052475716 9:28956690-28956712 AGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1052648303 9:31267677-31267699 AAGAGAGAAAGGAGGGAAGAAGG - Intergenic
1052656578 9:31370514-31370536 ATGAGAGAATGGGGAGATGATGG - Intergenic
1052734815 9:32330652-32330674 AGGAGGGGATGAAGAGAAGTTGG + Intergenic
1052752055 9:32501814-32501836 ATGAATGAAGGAAGAGAAGAAGG + Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053238829 9:36479459-36479481 ATGTGGGGGTGGAGAGAAGCAGG + Intronic
1054453920 9:65420099-65420121 AGGAGGGAGGGGAGGGAAGAAGG + Intergenic
1054454017 9:65420374-65420396 GTGAGAGATGGGAGAGAAGAAGG + Intergenic
1054943832 9:70773107-70773129 ATGAGAGAAGGGAGAGAAGATGG + Intronic
1054961694 9:70976927-70976949 ATGAGGAAATGGAGACTCGAAGG - Intronic
1055280731 9:74671165-74671187 AGGAGGGAAGGAAGAAAAGAAGG + Intronic
1056616290 9:88169208-88169230 AGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1056711754 9:88997372-88997394 TCCCGGGAATGGAGAGAAGAGGG - Exonic
1056869724 9:90266290-90266312 ATGAGGGAAGGAAGGAAAGAAGG - Intergenic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058387268 9:104452382-104452404 AGGAGGGAATGGATAGAAATGGG - Intergenic
1058466727 9:105236352-105236374 TTTGGGGGATGGAGAGAAGACGG + Intergenic
1058597618 9:106631725-106631747 ATGATGGAATGGAGAGTCAATGG + Intergenic
1058960449 9:109988510-109988532 AGGAAGGAAGGGAGGGAAGAAGG + Intronic
1059009146 9:110437784-110437806 TTGAGGGAAGGGTGAGAAGTGGG - Intronic
1059154348 9:111976678-111976700 AGGAAGGAATGGAGAGAAGGAGG + Intergenic
1059347828 9:113643542-113643564 AAGAAGGCAGGGAGAGAAGAAGG - Intergenic
1059723687 9:116985866-116985888 AGGAAGGCATGGAGAGCAGAGGG + Intronic
1059819925 9:117960971-117960993 TTGAGGAAATGGAGAGAAAATGG - Intergenic
1060235348 9:121858787-121858809 ATGAGGAACTGGAGATAAGGAGG + Intronic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060572571 9:124656142-124656164 AGGAGGCAAGAGAGAGAAGAAGG - Intronic
1060673323 9:125489969-125489991 TTGAGGGAAGGGAAAGGAGAAGG - Intronic
1061084371 9:128390572-128390594 AGGTGGGAAGGGAGAGAAAACGG - Exonic
1061259348 9:129471252-129471274 AGGAGGGCATTGAGAGAGGAGGG + Intergenic
1061374485 9:130215920-130215942 ATGGGGGAGGGCAGAGAAGAGGG - Intronic
1061498375 9:130988868-130988890 AAGTGGCAATGGAGAGAGGATGG + Intergenic
1062513268 9:136919678-136919700 ATGAAGGGATGAAGGGAAGAAGG - Intronic
1185485998 X:482033-482055 AGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1185525263 X:773534-773556 AAGAAGGAAGGGAGAGAGGAAGG + Intergenic
1185627293 X:1491934-1491956 GTGATGGAATGGACAGAAGGCGG + Intronic
1185708457 X:2282611-2282633 AAGAGGGGAGGGAGAGAAGAAGG + Intronic
1185726625 X:2426878-2426900 AGGAGGGAAGGGTTAGAAGATGG - Intronic
1185872979 X:3680030-3680052 ATGAGGGAATGCAGAGAGAGTGG - Intronic
1185915003 X:4025686-4025708 AGGAGGGAAGGAAGGGAAGAAGG - Intergenic
1185984585 X:4817629-4817651 AGGAGGAAAAGAAGAGAAGAAGG - Intergenic
1186053629 X:5626580-5626602 AGGAGGGAAGGGAGAAAGGATGG + Intergenic
1186189189 X:7052571-7052593 ATGGGGTAATGGAAAGAAAAAGG - Intronic
1186190005 X:7058844-7058866 ATGAAGGAAGGGAGAGCAGGAGG - Intronic
1186239903 X:7555054-7555076 AGGAGGAAATGAAGAGAGGATGG + Intergenic
1186240384 X:7559203-7559225 AGGATGGAAGGAAGAGAAGAAGG - Intergenic
1186246596 X:7622406-7622428 AGGAAGGAAGGGAGAGAAGGAGG - Intergenic
1186269189 X:7866473-7866495 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1186375866 X:8999804-8999826 ATGAGAGAAAAGAGAGTAGACGG - Intergenic
1186792748 X:13014989-13015011 AACAAGGAAAGGAGAGAAGAAGG - Intergenic
1186932125 X:14405369-14405391 AGGAGGGAAGAGAGTGAAGAGGG + Intergenic
1187431844 X:19232235-19232257 GTGAGGGCACGGTGAGAAGACGG + Intergenic
1187452858 X:19413853-19413875 AAGGGGAAAAGGAGAGAAGAAGG + Intronic
1187652553 X:21425006-21425028 AGGAGGGAAGGAGGAGAAGATGG - Intronic
1187771816 X:22706874-22706896 AAGAGAGAAGGGAGGGAAGATGG + Intergenic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188370002 X:29358180-29358202 AGGAGGGATAGGAGACAAGAGGG + Intronic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188845503 X:35066999-35067021 ATGAGGACGTGGAGAAAAGAGGG - Intergenic
1189104027 X:38219165-38219187 ATGAGAGAAAGGAGAGGGGAGGG + Intronic
1189212170 X:39292629-39292651 ATGAGTGAATGGAGAGGTGGTGG - Intergenic
1189760923 X:44320789-44320811 AGGAGTGAATGGAGGGGAGAAGG - Intronic
1190259833 X:48790880-48790902 AGGAGGGAAAAGAGAGGAGAGGG + Intronic
1190284475 X:48953119-48953141 ATGAGAGAATTGAGGGATGATGG + Intronic
1190585812 X:51940553-51940575 ACTAGAGGATGGAGAGAAGAAGG - Intergenic
1190636703 X:52441947-52441969 AGGAGGAAATGGGGAGATGAAGG - Intergenic
1190832484 X:54071615-54071637 ATGAAGGTTTGGAGAGAAAAGGG - Exonic
1190971072 X:55348332-55348354 TTGGGGGAATGAAGAGATGATGG - Intergenic
1191174267 X:57482687-57482709 TTGAGGGAATGAAGCCAAGATGG - Intronic
1191937728 X:66443037-66443059 AGGAGGGAATGGGGAGAAGAGGG - Intergenic
1192176575 X:68889943-68889965 ATGAAGGAATGCAGAGAAATGGG + Intergenic
1192341139 X:70264336-70264358 ACGAAGGAAGGGAGAGAAGGAGG + Intergenic
1192912125 X:75616396-75616418 ATGAGGGGGTGGAGCCAAGATGG + Intergenic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1193711224 X:84882712-84882734 ATGAGGGAAAGGAGAGAGAAGGG + Intergenic
1194256227 X:91638260-91638282 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1194309163 X:92282111-92282133 ATAAGGGGAAGGAGAGAAAAGGG + Intronic
1194677244 X:96809166-96809188 AAGTTGCAATGGAGAGAAGACGG - Intronic
1194680027 X:96841425-96841447 GGAAGGGAATGGAGAGGAGAAGG - Intronic
1195017104 X:100790900-100790922 AAGAGGGAATGGAGGGTGGAAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195625384 X:107000766-107000788 ATGAAGGAATGAAGAAAACAAGG + Intergenic
1195870565 X:109481025-109481047 AGGAATGAAGGGAGAGAAGAAGG + Intronic
1195933671 X:110105140-110105162 AGGAAGGAAGGGAGAGAGGAAGG - Intronic
1196090821 X:111740157-111740179 ATGATAGAATTGAGAGAATATGG + Intronic
1196208399 X:112967423-112967445 ATGAGGGGCAGGAGACAAGAGGG + Intergenic
1196376005 X:115033278-115033300 AGGAGGGAAAGGAGAGAATGTGG - Intergenic
1196377920 X:115055200-115055222 GTGAGGGAAGAGAGAGAACAAGG - Intergenic
1196417501 X:115487171-115487193 CTGAGGGAATGGGGAGAATGAGG + Intergenic
1196830091 X:119768971-119768993 ATGAAGGGAAGGAGGGAAGATGG - Intergenic
1196871317 X:120116003-120116025 GAGAGGGAATGGAGAGGAGTGGG + Intergenic
1197165847 X:123376913-123376935 AAGAGTGAATGAAAAGAAGAGGG - Intronic
1197334526 X:125195988-125196010 AGGAGGGAAGGAAGAAAAGAAGG + Intergenic
1197357879 X:125459008-125459030 ATGAAGAAATGGAGAGTAAATGG - Intergenic
1197727453 X:129785868-129785890 AAGAGGGAACGGAGAGAGGGTGG - Intronic
1197816537 X:130504448-130504470 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816547 X:130504486-130504508 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816562 X:130504537-130504559 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197816574 X:130504575-130504597 AGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1197836980 X:130705602-130705624 GGGAGGGAAGGGAGATAAGAAGG - Intronic
1198097503 X:133394481-133394503 ATCAGGGCAAGGAGAAAAGAGGG + Intronic
1198162857 X:134024805-134024827 AAGATGGAATGGAAAGTAGAAGG + Intergenic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198673550 X:139107596-139107618 AGGAGGGAAAGGAGAGAGGGAGG + Intronic
1198730472 X:139722512-139722534 ATTTGGGAATGGAGAAAGGAAGG + Intergenic
1199066711 X:143427644-143427666 AAGAGGCAAAGGAGAGAAAAAGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199589880 X:149457501-149457523 TTCAGGGCATCGAGAGAAGAGGG + Intergenic
1199595766 X:149504835-149504857 AAGAGGGAAGGGAGGGATGAAGG + Intronic
1199770092 X:150969646-150969668 ATGAGGGAAAGGAGAGAAGGCGG + Intergenic
1200118555 X:153779962-153779984 ACAAGGGAATGGAGAGGCGAGGG - Intronic
1200396624 X:155993595-155993617 AGGAGGGAATGGAGAGTTGTTGG + Intergenic
1200574956 Y:4877544-4877566 AGGAAGGAATGGAGGGAGGAAGG - Intergenic
1201267140 Y:12218278-12218300 AAGAAGGAAGGGAGAGAGGAAGG - Intergenic
1201363116 Y:13175009-13175031 ATGAGGGAATGGAGAAGGGTAGG + Intergenic
1201463614 Y:14255757-14255779 AGGAGGGAGAAGAGAGAAGAAGG - Intergenic
1201470008 Y:14322726-14322748 AGGAAGGAAAGGAAAGAAGATGG - Intergenic
1201517703 Y:14835676-14835698 AAGAAGGAAGGGAGAGAGGAAGG + Intronic
1201730322 Y:17195220-17195242 TTGAGAGAATGAAGAGAAGGTGG - Intergenic
1202234143 Y:22690683-22690705 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic
1202309015 Y:23505483-23505505 AGGAAGGAAGGGAGAGAGGAAGG - Intergenic
1202561785 Y:26165105-26165127 AGGAAGGAAGGGAGAGAGGAAGG + Intergenic