ID: 1048457345

View in Genome Browser
Species Human (GRCh38)
Location 8:134590347-134590369
Sequence CTCTTTCTATTAAGGACAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048457345_1048457347 13 Left 1048457345 8:134590347-134590369 CCTTTTGTCCTTAATAGAAAGAG 0: 1
1: 0
2: 1
3: 20
4: 229
Right 1048457347 8:134590383-134590405 GACTTTCTCATTTAAATCTGTGG 0: 1
1: 0
2: 1
3: 23
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048457345 Original CRISPR CTCTTTCTATTAAGGACAAA AGG (reversed) Exonic
902364227 1:15960634-15960656 TTCTTTCTACAAAGGACACAAGG + Intronic
905835326 1:41114681-41114703 CTCTTTCTTTTTTGGAGAAAGGG + Intronic
906847966 1:49214897-49214919 CTCTTTCTTATGAAGACAAAGGG + Intronic
908481080 1:64540129-64540151 ATCTATCCATTAAGGACAAAGGG - Intronic
908840344 1:68274066-68274088 CTCTGTATAATAAGGACAACAGG + Intergenic
910425121 1:87113947-87113969 CTCTTTCTCTTAAAAAAAAAGGG - Intronic
911010068 1:93271365-93271387 ATCTTTCTTTTAAAGAGAAAAGG - Intronic
911573389 1:99544856-99544878 CTGCCTCTATTAAAGACAAATGG + Intergenic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
913407293 1:118509472-118509494 CTCTTTCTATTCAGAACTCATGG + Intergenic
916160500 1:161907587-161907609 TCCTTTCTATTAAAGATAAAGGG + Intronic
916565270 1:165970309-165970331 TTCATTCTATTGAGGAAAAAAGG + Intergenic
916874080 1:168950035-168950057 CTCTTTCTATGGAAAACAAATGG - Intergenic
919528285 1:198680967-198680989 CTTGTTTTATAAAGGACAAAAGG - Intronic
920736745 1:208539738-208539760 CTTTTTCTTTTAATGCCAAATGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
921838504 1:219802921-219802943 CTCTTGCTTTCAAGGATAAAAGG - Intronic
922435212 1:225598568-225598590 CTCTATGTTTTAAGGGCAAATGG + Intronic
923834018 1:237589906-237589928 CTGTTTGTATTAACGGCAAATGG - Exonic
924211571 1:241773357-241773379 CTGCTTCTATTAGGGACATAAGG - Intronic
1063056720 10:2513090-2513112 CTCATTCTCTTCAGCACAAATGG + Intergenic
1065181838 10:23134118-23134140 TTCTTTCTATTATGAACTAATGG - Intergenic
1065923492 10:30414166-30414188 CTATTTCTATTATGGCCACATGG + Intergenic
1066516793 10:36171374-36171396 CTCTTTCCATTATAAACAAAAGG + Intergenic
1068769388 10:60803919-60803941 ATCTTTATTTTAAGGGCAAAAGG - Intergenic
1070751385 10:78965918-78965940 CTTTTTCTATGTAGGACACATGG - Intergenic
1071791152 10:88955624-88955646 CACTTTCTATGAAGGTCTAAAGG + Intronic
1072111544 10:92325334-92325356 CTCTTTTTATTTAAGACATAAGG - Intronic
1072395760 10:95038857-95038879 CTCTTTCCTTTAAATACAAATGG + Intronic
1072789846 10:98309971-98309993 CTCTTTCTAACAAGGAACAAAGG + Intergenic
1073453629 10:103623616-103623638 CTGCTTCTTATAAGGACAAAAGG + Intronic
1073788232 10:106913545-106913567 TTCTATCTATTAAGGAGACAAGG + Intronic
1073834143 10:107421361-107421383 CTCTTTCTCTTTAGCAAAAATGG + Intergenic
1075118865 10:119650070-119650092 CTCTTTCTTTTAAAGAGATAGGG + Intergenic
1075835485 10:125449306-125449328 TTCTTTCTATTAAAAAAAAATGG + Intergenic
1076046179 10:127295828-127295850 CACCTTCTCTTAAGAACAAAAGG - Intronic
1076387449 10:130067446-130067468 CTCTGCCCATTAAGGAAAAATGG - Intergenic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1081408219 11:42722978-42723000 TTCTTTCTACATAGGACAAAAGG + Intergenic
1082169142 11:48981241-48981263 CTATTTCTATACAGGACACATGG - Intergenic
1082315576 11:50714529-50714551 CTTTTTCTAGTAACTACAAATGG - Intergenic
1087277353 11:96173917-96173939 CTGTTTCTCTTCAGGACAAGGGG + Intronic
1088133672 11:106527249-106527271 CTCTTTGGCCTAAGGACAAAAGG - Intergenic
1088170849 11:106994824-106994846 TTCATTCCATTAAAGACAAAAGG - Intronic
1088859223 11:113784277-113784299 CTCTCTTTATAAAGGACAAAAGG + Intergenic
1089915531 11:122152072-122152094 CTCATTCATTTCAGGACAAAAGG + Intergenic
1092572853 12:9744260-9744282 CTCTTTCCACTGAGGACAATTGG + Intergenic
1093103321 12:15054519-15054541 CTCTCTCTTTGAAGAACAAAAGG + Intergenic
1095368458 12:41437473-41437495 CTCTGTTTATTAAGGATAGAGGG - Intronic
1095921872 12:47539972-47539994 CTCTCTCTACAAAGTACAAATGG + Intergenic
1096378950 12:51139048-51139070 CTCTGTCTATAAAAGACAAGGGG - Intronic
1099034840 12:77573351-77573373 CTGCCTCTATTAATGACAAAAGG - Intergenic
1099664280 12:85607717-85607739 CTATTTCAATTAAGGATCAAAGG + Intergenic
1100783388 12:98053498-98053520 CTCTTTATAATAAGAACAAATGG - Intergenic
1102230828 12:111261090-111261112 ATTTTTCTATCCAGGACAAAAGG + Intronic
1103822574 12:123710862-123710884 TTCCTTCTTTTAAGTACAAAAGG - Intergenic
1104526882 12:129532409-129532431 CTATTAATATTAGGGACAAAAGG + Intronic
1105828848 13:24146155-24146177 CACTTTCTATTTAGGATAGAGGG + Intronic
1106548432 13:30750735-30750757 CTCTTTATTTTAAGGCCAACTGG - Intronic
1107641782 13:42451625-42451647 CTCTTTAAATAATGGACAAAAGG + Intergenic
1107717249 13:43212686-43212708 CTCTTTATTTTAATAACAAATGG - Intergenic
1110352072 13:74520570-74520592 CACTTTCTATGAAAGACAAAGGG - Intergenic
1111635477 13:90898043-90898065 CTGTTTGAATTTAGGACAAAAGG + Intergenic
1113284335 13:108829788-108829810 ATCCTTTTATTAAGGTCAAAAGG - Intronic
1115833458 14:37369900-37369922 CACTTTTTATTAACTACAAAAGG - Intronic
1116482126 14:45403793-45403815 TTCCTTGTATTAAAGACAAAGGG + Intergenic
1118160936 14:63289548-63289570 CTTTTACTATTAAGGACATCTGG - Intronic
1119377765 14:74208473-74208495 CTATTTCTATCAAGGAAAATGGG - Intergenic
1123971867 15:25515073-25515095 CTCTTTCTTTTGAGTACAAATGG + Intergenic
1124186806 15:27537766-27537788 CTAGTTGTATTAAGGCCAAAAGG + Exonic
1125357345 15:38830359-38830381 CTCTTTCAGTTAAAGATAAAAGG + Intergenic
1127620256 15:60726899-60726921 TTCTTTCTATTGAGGATTAAGGG - Intronic
1127771934 15:62239281-62239303 CTCTTTCTTTTAAGTAGGAATGG - Intergenic
1132360536 15:101209485-101209507 CTTTTTGTTTTAAGGAAAAAGGG + Intronic
1138140609 16:54565149-54565171 CTCTTTCATTTCTGGACAAAGGG + Intergenic
1138336690 16:56258966-56258988 CACTTTCCATAAAGAACAAAGGG - Intronic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1139109875 16:63877068-63877090 CTCTTTCTATAAAGCTCAACTGG + Intergenic
1141028713 16:80570431-80570453 GTCTTTTTATTAAGATCAAAAGG - Intergenic
1142831654 17:2553660-2553682 CTCTTTCTAGTGATGTCAAAAGG + Intergenic
1146825379 17:36018053-36018075 CTCTTTCTAAAAAGGAAACAAGG + Intergenic
1148518720 17:48248072-48248094 CTATTTCTATTAAGGCAAATAGG + Intronic
1149083836 17:52690502-52690524 CCCTTTCTATTAAAAAGAAATGG - Intergenic
1150450819 17:65266210-65266232 CTACTTCTACTAATGACAAAAGG - Intergenic
1153603684 18:6809360-6809382 TTCATTCTAGTAAGGGCAAATGG - Intronic
1154073310 18:11175562-11175584 TTCTTTCTCTTAGGGAAAAAGGG - Intergenic
1157607858 18:48937526-48937548 CTCATTCTTTCCAGGACAAAAGG + Intronic
1157840091 18:50949290-50949312 TTCTTTTAATTAAAGACAAAAGG + Exonic
1159089588 18:63832833-63832855 CTCCTTCCACTAAGGACAAACGG + Intergenic
1163285647 19:16345654-16345676 TTCTTTGTACTAAGGACAAAGGG - Intergenic
1163307314 19:16488858-16488880 CTTTTTCTATAAAGGCCAGATGG + Intronic
1164467924 19:28503764-28503786 TTCTTTCTAATCAGGAGAAAAGG + Intergenic
1164840618 19:31389858-31389880 CTCTATGTTTTTAGGACAAAAGG - Intergenic
1164948652 19:32317744-32317766 CTTTTTCTTTTAAGAAAAAAGGG - Intergenic
1166538370 19:43590336-43590358 CTCTTTCTGTCTACGACAAAAGG + Exonic
927633190 2:24792259-24792281 CTTTTTATAATAAGGAAAAACGG - Intronic
928500958 2:31894803-31894825 TTCTTTCTTTTAATGAGAAATGG + Intronic
928800099 2:35078996-35079018 CTCTATTTTCTAAGGACAAATGG - Intergenic
935920067 2:108002889-108002911 CTTTTTCTATTAAGCTTAAAGGG + Intronic
935934266 2:108165023-108165045 CTCTTTCTTTCCAGGGCAAAAGG - Intergenic
936169712 2:110158242-110158264 CACTTTCTCTTAAGTACATATGG - Intronic
936627896 2:114168071-114168093 CTCTTTCTTTTAAGCAAAACAGG - Intergenic
938654484 2:133417157-133417179 TTCTTTCTTTTAAGGACCACAGG + Intronic
941288103 2:163640407-163640429 CTCTATATATTAAGGAGATACGG - Intronic
942217325 2:173734164-173734186 TTCTCTCCATCAAGGACAAATGG + Intergenic
942872422 2:180751063-180751085 CTTTCTCTATTGTGGACAAAGGG + Intergenic
943509601 2:188808247-188808269 CACTTTCTATTATATACAAAAGG - Intergenic
943602008 2:189932157-189932179 GTCTTTCTTTTTATGACAAATGG + Intronic
944029013 2:195210105-195210127 CTCTTTCTAATAAGGACACAAGG + Intergenic
948225543 2:236306734-236306756 CTCATTCTAATAAGGAAAGAAGG + Intergenic
1169693699 20:8362906-8362928 CTTTTTCTATTATGTACATAGGG + Intronic
1173578361 20:44128258-44128280 CTGTTTCTAATAAGAAAAAATGG + Intronic
1176986463 21:15442998-15443020 CTCTTTCTCCTAAGTGCAAAGGG - Intergenic
1177096624 21:16843236-16843258 CACTTTCTGTTCAGAACAAAAGG - Intergenic
949604880 3:5641807-5641829 CTCTTCCTAATAAGAAGAAATGG + Intergenic
952090569 3:29880520-29880542 CTCTTTCCACAAAGGAAAAAAGG - Intronic
953090538 3:39721351-39721373 TTCTTTTTATTTTGGACAAATGG - Intergenic
955627951 3:60939410-60939432 CTTTTTCTGTAAAGGACTAAAGG - Intronic
955743541 3:62118172-62118194 CTTTTTCTATAAAGGGCCAAAGG + Intronic
955874990 3:63479535-63479557 CTTTTTCTATTAAAGATAAATGG + Intronic
956173059 3:66448044-66448066 TTCTGTTTATTAAGGACAAATGG + Intronic
957875185 3:86135864-86135886 GTTTTTCTATTAGGAACAAAGGG - Intergenic
958410475 3:93809430-93809452 CTATTTCTGTTAAGGGCATATGG + Intergenic
958783246 3:98567994-98568016 CACTTTCTGTTTAGGAAAAATGG - Intronic
959055635 3:101564848-101564870 CTCTTCCTATGAAGGGTAAATGG - Exonic
960411312 3:117329152-117329174 CTCTTTCTAGTAAATAGAAAAGG - Intergenic
960647715 3:119907527-119907549 CTCTTACTTCAAAGGACAAATGG + Intronic
962406056 3:135101048-135101070 CCCTTTCTCTTAAGGAAACAAGG + Intronic
962786379 3:138771830-138771852 CTCTTTCTCTTGAGCACAGAAGG + Intronic
963554099 3:146764337-146764359 CTCTTTCTATTCAAGAAACATGG + Intergenic
963854861 3:150242960-150242982 CCCTTTCTATTCAGCACAGAGGG - Intergenic
964103637 3:153017128-153017150 CTCATGCTGATAAGGACAAAGGG + Intergenic
964744267 3:159997628-159997650 CTTTTTCTATTAAGGAGGAATGG - Intergenic
965486875 3:169288955-169288977 CTTTTTTTATGAAAGACAAAAGG + Intronic
966669901 3:182515376-182515398 CACTTTCTATTAAAGTCATATGG - Intergenic
968189429 3:196656893-196656915 CACTTTCTAATAAGGTCAAATGG - Intronic
968223402 3:196956183-196956205 TACTTTCTATAAATGACAAAGGG - Intronic
968824516 4:2884727-2884749 CTCTTTCCATTTAGGAGAAGAGG + Intronic
971533059 4:27713498-27713520 CTCCTTCCATTAAGGAGTAAGGG - Intergenic
971913689 4:32830796-32830818 CTCTTTGTATTATGTACAATAGG - Intergenic
972127041 4:35780929-35780951 CACTTCCTATTAAGGATCAAAGG + Intergenic
973029301 4:45315433-45315455 CTCTTTTTATTTAGAAGAAAGGG + Intergenic
973128897 4:46624930-46624952 CTTTGTCTATTAAGGATTAAGGG + Intergenic
977816735 4:101422813-101422835 CTCTTACTTTTAAGAAAAAATGG - Intronic
977923910 4:102677136-102677158 TTCTTTCTATCAAGTAAAAATGG - Intronic
979220878 4:118222763-118222785 CTCTTTCTGATAAAGACAGATGG - Intronic
979375935 4:119946919-119946941 CAATTTCTATTAAGGAAAAGGGG - Intergenic
980289399 4:130826071-130826093 CTCATTCTGATAAGGAGAAATGG - Intergenic
980329506 4:131391738-131391760 GTCCATCTATTTAGGACAAATGG + Intergenic
980610663 4:135157158-135157180 CTCTTTCTATAATATACAAATGG + Intergenic
981738371 4:147976638-147976660 CTCTTTCCTTTAAGGAGAGAAGG + Intronic
981965157 4:150591504-150591526 ATATTTGTATAAAGGACAAAAGG - Intronic
982634283 4:157872973-157872995 CTTTTTCTTTTAAGGTCAGATGG - Intergenic
984248508 4:177304538-177304560 CTTTTTTTAATAAGGACAAGGGG - Intergenic
984658607 4:182348058-182348080 TTCTTTCTATTCATGAAAAAAGG + Intronic
984710901 4:182883614-182883636 CTCTTTCTTTGAAGTAAAAATGG - Intergenic
985953255 5:3239199-3239221 CTCTTTCTAGTAAAGATGAAAGG - Intergenic
987221945 5:15799666-15799688 CTCTTTCTAAAAAGGAAAAAAGG + Intronic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
992918148 5:81481188-81481210 CTCTTTCCATGAATCACAAATGG + Intronic
993244927 5:85438919-85438941 CTCTTTCTGATAAGGCAAAAGGG + Intergenic
993704204 5:91151032-91151054 CTCTTTATATTAAGGAGCCAAGG + Intronic
995769812 5:115656485-115656507 CTTTTTGTTTTAAGGACATAGGG + Intergenic
996308798 5:122079591-122079613 TTCTTTCTAGTAAGAACAACCGG + Intergenic
999443397 5:151620217-151620239 CTGGGTCTATGAAGGACAAATGG - Intergenic
1000002738 5:157154500-157154522 CACTTTCTAGAAAAGACAAAGGG - Intronic
1000048720 5:157543775-157543797 CCCTTTCTATCAAGCAGAAATGG + Intronic
1000053835 5:157586002-157586024 ATGTTTCTATTAGGGTCAAATGG - Intergenic
1000780742 5:165477652-165477674 CTCCTTCCAGTAAGGAGAAATGG - Intergenic
1002557550 5:180055521-180055543 CTCTCTTTATTTAGGACAACTGG - Intronic
1003172600 6:3731996-3732018 CTCCTTCAATTAACTACAAAGGG - Intronic
1003564940 6:7214839-7214861 CACTTTTTATTAAGGAACAATGG - Intronic
1004309555 6:14532365-14532387 CACTTTCTTTAAAGGATAAAGGG - Intergenic
1005003055 6:21262090-21262112 CTCATTCTATTAAAGACTAGAGG - Intergenic
1005699669 6:28387851-28387873 CTTTTTATGTTAAGGGCAAAGGG - Intronic
1005822795 6:29611593-29611615 CTCTTTGTATCCAGGACAAGAGG - Intronic
1007519633 6:42441623-42441645 CTCCTTCCATTAAGAACCAATGG + Intronic
1008858238 6:56116685-56116707 GTCTTTCTATTTAGGATAAGAGG - Intronic
1009407812 6:63331365-63331387 CTCTCTCTGATAAGGAAAAATGG - Intergenic
1009632565 6:66217147-66217169 CTATATCCATTAAGGAAAAATGG - Intergenic
1011951492 6:92971472-92971494 CTCTGCCTATTAAGCAAAAAAGG + Intergenic
1015204043 6:130614953-130614975 ATCTTTCTATTAAGGATAGATGG - Intergenic
1015295670 6:131589337-131589359 TTTTTTCTTTTAAGGAAAAAGGG - Intronic
1016453816 6:144210554-144210576 CTTTTTATGTTAAGGGCAAAGGG - Intergenic
1016574175 6:145549239-145549261 ATCTATCTGTTAAAGACAAAAGG + Intronic
1019763139 7:2829113-2829135 CTCATTGTATGAAGTACAAAGGG + Intronic
1020376114 7:7489312-7489334 TTCTTTCTGTTTAGGATAAATGG - Intronic
1020439024 7:8197620-8197642 GTCTTTCTATTAAAGATGAAGGG + Intronic
1020597792 7:10231060-10231082 CTCTTTTCATGAAGGAAAAAAGG - Intergenic
1020816759 7:12915183-12915205 GTCTTTACATTAAGGACAAAAGG - Intergenic
1021211899 7:17863829-17863851 CTCTTTCTCTTAATTACAAAGGG - Intronic
1021387329 7:20047100-20047122 CTCTTTCATTTAAGTATAAATGG - Intergenic
1022250699 7:28605033-28605055 CTCTTTTTTTTAATGAGAAAGGG - Intronic
1023446143 7:40233990-40234012 GTATTTCTATTAAAGAGAAAAGG - Intronic
1024867290 7:53918723-53918745 CTCTTGCTCTTAATAACAAATGG - Intergenic
1026406329 7:70070158-70070180 CTCTCTCTTTTAGGCACAAATGG - Intronic
1027340450 7:77202243-77202265 CCCTTTCTAAGAAGGAAAAAGGG - Intronic
1027658177 7:80957247-80957269 CTCTTTAAAATTAGGACAAAGGG - Intergenic
1028311350 7:89341147-89341169 CTCTTGCTATTTAAGAAAAATGG - Intergenic
1030846349 7:114417698-114417720 ATCTTTATTTTAATGACAAAGGG + Intronic
1030902464 7:115141273-115141295 CTATTTCTATCAGGGAGAAATGG + Intergenic
1031032787 7:116752741-116752763 CACTTTCTATAAAAGGCAAACGG - Intronic
1031668594 7:124516368-124516390 ATCTTTTTATTAAAAACAAAGGG - Intergenic
1032641629 7:133775614-133775636 TTCTTTGTATTAAGTACAGAGGG + Intronic
1032730512 7:134637679-134637701 CTCTTTCTGTAAATGACACATGG + Intergenic
1033294628 7:140120394-140120416 CTATTTTTAAAAAGGACAAAAGG + Intronic
1036112252 8:5916099-5916121 TTCTTTCTAAAAAGGTCAAAAGG + Intergenic
1037250097 8:16882065-16882087 CTCTGTCTCTTAAAGAAAAAGGG + Intergenic
1037506854 8:19539314-19539336 TTCTTTCTATGAAGGTCAAAAGG - Intronic
1038723976 8:30062574-30062596 ATCCTTCTACTAAGGAGAAATGG + Intergenic
1041828567 8:62126444-62126466 TTCCTTCTATTAAGAAGAAAAGG + Intergenic
1042815478 8:72873764-72873786 GTCTTTCCATTGAGAACAAAGGG + Intronic
1043919306 8:85962836-85962858 CTCTGTCTCTTAAGCAAAAAAGG + Intergenic
1043989654 8:86737429-86737451 TTGTTTCTATTTAGGAGAAAAGG - Intronic
1046101101 8:109615050-109615072 CTCTTTATCTTAATGACCAAAGG + Intronic
1046751277 8:117929630-117929652 CTGCTTCTATTAGGGACATAGGG + Intronic
1047936521 8:129786023-129786045 CTATTTCTCTACAGGACAAAGGG - Exonic
1048457345 8:134590347-134590369 CTCTTTCTATTAAGGACAAAAGG - Exonic
1048755860 8:137737586-137737608 CTTTTTCTGTTAAGGACAGGGGG - Intergenic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1050262777 9:3858220-3858242 CTCTTTCTGTTGAGGACTGATGG + Intronic
1050386310 9:5094658-5094680 CTCTTTCTGTTAAGTCAAAAGGG - Intronic
1050423011 9:5486672-5486694 GTGTTTGTATTAAGGTCAAAGGG - Intergenic
1051701525 9:19829231-19829253 CTCTTTCTATGAAGTCCATAGGG + Intergenic
1052155616 9:25185858-25185880 TTCTTTCTATTATTGAGAAAAGG - Intergenic
1052395910 9:27937920-27937942 CTCTTCCAATAAAGGAGAAAAGG + Intergenic
1055399968 9:75912847-75912869 CTCTTTTTGTAAATGACAAAGGG + Intronic
1055526896 9:77143821-77143843 CACTTAATATTAAGGAAAAATGG + Intergenic
1058032003 9:100210203-100210225 CACTTTCTATTACGGTCAAAGGG + Intronic
1058265501 9:102894135-102894157 CTCTTTATATTAAGGGGAAGAGG + Intergenic
1058748935 9:108019872-108019894 CTCCTTCTATTTAAGACAAGTGG + Intergenic
1059507437 9:114812762-114812784 ATCTTGCTATTAAGGAGCAAAGG + Intergenic
1059861937 9:118474311-118474333 CTCTTTCTCTTAAAAACAACAGG - Intergenic
1059898855 9:118899728-118899750 TCCTTTCTATTTAGGACTAATGG - Intergenic
1062065004 9:134522009-134522031 CTCTTTCTAACAGGGACAAATGG - Intergenic
1185811836 X:3117655-3117677 ATCTTTCTATTTAGGGAAAAAGG - Intergenic
1185938616 X:4288001-4288023 CTCTTCCTACAAAGAACAAAAGG - Intergenic
1187028235 X:15457965-15457987 TTTTTTCTATAAAGGGCAAATGG - Intronic
1187258010 X:17658821-17658843 CCCTTTCTATTTAAGACCAAGGG - Intronic
1187817492 X:23248587-23248609 TTCTTTTTTTTAAAGACAAAAGG + Intergenic
1187990060 X:24860747-24860769 CTCTATCTGTTAAAGACAAAAGG - Intronic
1188015077 X:25099390-25099412 CTCTCTCTTGTAAAGACAAAGGG + Intergenic
1188520364 X:31031872-31031894 CTCTTTCTCTCTAGAACAAAAGG + Intergenic
1189464777 X:41270020-41270042 CTCTTTCTTTTGTGGACAAGTGG - Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1193629432 X:83864070-83864092 CTTTTTCTTATAAGAACAAAGGG - Intronic
1194651590 X:96521675-96521697 TTCTTTGTCTTAAGAACAAAAGG + Intergenic
1196002717 X:110803990-110804012 CTCCTTCCTGTAAGGACAAAAGG - Intergenic
1200404208 Y:2792611-2792633 CTCTTTGTTTTAAGGAAGAAAGG - Intergenic
1201269457 Y:12240701-12240723 ATCTTTCTATTTAGGGAAAAAGG + Intergenic