ID: 1048458309

View in Genome Browser
Species Human (GRCh38)
Location 8:134598364-134598386
Sequence TTCAATGTGAACATGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048458309_1048458311 -3 Left 1048458309 8:134598364-134598386 CCATCCTACATGTTCACATTGAA 0: 1
1: 0
2: 0
3: 18
4: 178
Right 1048458311 8:134598384-134598406 GAAGAGATAAGCCTCTCAGAAGG 0: 1
1: 0
2: 1
3: 21
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048458309 Original CRISPR TTCAATGTGAACATGTAGGA TGG (reversed) Intronic
902259338 1:15212787-15212809 TGGAATATGAACAGGTAGGATGG - Intronic
904870489 1:33614789-33614811 TTCAATATGTACATTCAGGAAGG + Intronic
905054744 1:35083406-35083428 TGCAATTTGAACATGTCGGGAGG - Intronic
906848992 1:49227299-49227321 TTCAATGATAACATGTAGATAGG + Intronic
907982164 1:59494344-59494366 ATCAGTGTGAACATGTGGGCAGG + Intronic
912926309 1:113916229-113916251 TTCAATGAGCACATTGAGGATGG - Intergenic
912977128 1:114341068-114341090 TTCAATATGTAAATGTTGGAGGG + Intergenic
916987938 1:170211764-170211786 TTGAATGGAAACATGTTGGAGGG + Intergenic
918347922 1:183622795-183622817 TTCAATGTGGACAGTTAAGAAGG - Intergenic
920557193 1:206912861-206912883 GGCAATGTGAAAATGGAGGAGGG - Intronic
920685319 1:208104725-208104747 TTAAGTGTGATGATGTAGGAAGG - Intronic
1063949881 10:11212425-11212447 TTCACTGTCAACATCTAGCAGGG - Intronic
1065300747 10:24319052-24319074 TTCACAGAGAACATCTAGGAGGG + Intronic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1070421575 10:76242592-76242614 GACAATGTGAACATGTAGAGAGG - Intronic
1071167277 10:82821745-82821767 TTCAATGGGAAAATGTAGTCAGG - Intronic
1073510560 10:104040053-104040075 TTCAATGGGCCCATGGAGGAGGG + Intronic
1073648156 10:105328508-105328530 TTCCATGTGTATATGTAGGCAGG - Intergenic
1074579955 10:114709848-114709870 ATCAAAGTGAATATTTAGGAAGG - Intergenic
1076007115 10:126956619-126956641 TTTATTGTGCACATGTAGGGTGG + Intronic
1078453117 11:11454971-11454993 TTCAATGTCAACAATGAGGAAGG - Intronic
1079347581 11:19666696-19666718 TTCAAGGGCAACATGTATGAAGG - Intronic
1080459678 11:32442647-32442669 TTACATGTGAACATGTGGAAAGG + Intergenic
1080489539 11:32748086-32748108 TCCAATAAGAACATGTAGGATGG - Intronic
1080948266 11:36999125-36999147 CTCAATGTAAACTTGTTGGAGGG - Intergenic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1087414734 11:97839791-97839813 TTAAGTGAGAACATGTAGTATGG - Intergenic
1087419444 11:97902407-97902429 TTTTAAATGAACATGTAGGAAGG + Intergenic
1088756246 11:112887650-112887672 TTCTAGGAGAACATGCAGGATGG - Intergenic
1091626051 12:2121816-2121838 TTAAATGTGAAACTGTAGGAGGG - Intronic
1091893592 12:4082889-4082911 CTGAATGTGAACATGTGAGAAGG - Intergenic
1091966243 12:4744664-4744686 TTCAATGTGAGCATCCAAGATGG - Exonic
1093132638 12:15410564-15410586 TGCAATCTGGACATGCAGGAAGG - Intronic
1093448089 12:19283239-19283261 TAAAATGTAAACATGAAGGAGGG - Intronic
1095708463 12:45262988-45263010 GTCTATGGGATCATGTAGGAGGG + Intronic
1095795642 12:46216135-46216157 TGCAAGGTGAAGATGCAGGAGGG - Intronic
1096233196 12:49908930-49908952 TTGTCTGTGAACATGTGGGAGGG + Intergenic
1102624038 12:114220298-114220320 TTCAAGGAGAAAAAGTAGGAAGG - Intergenic
1102747303 12:115260434-115260456 TCCAATGTGAAAATGTCAGAGGG - Intergenic
1103314122 12:120038527-120038549 TTTAATGTGAGCAGGTGGGATGG - Intronic
1105687761 13:22803143-22803165 TTCATTGTGAATCTTTAGGAAGG - Intergenic
1106070064 13:26402127-26402149 ATCAATGTGAAGCTGTAGTAAGG + Intronic
1107109833 13:36684981-36685003 TTCAATTTGAAAATGTAAGAAGG - Intronic
1108062467 13:46547099-46547121 TACATTGTGAACATGGAAGAAGG - Intergenic
1108835381 13:54539832-54539854 TGCAATGTGAACAAGTAGGCTGG - Intergenic
1108909499 13:55526945-55526967 TTTTATGTGAACATGAAGGTAGG + Intergenic
1110621546 13:77601376-77601398 TTCAATGTGAGAAAGAAGGAAGG - Intronic
1111930218 13:94504902-94504924 TCCAATGAGAAGAGGTAGGAGGG - Intergenic
1112686240 13:101831104-101831126 TCCAATGTGAACATTTTGGTGGG + Intronic
1116261146 14:42629082-42629104 GTCAATGTGAAGTTGTAGGCAGG - Intergenic
1117866506 14:60155150-60155172 TTCAATGTGAACATAATGGCTGG + Intronic
1120888506 14:89471009-89471031 TCCACAGTGAACATGTAGGAGGG + Intronic
1121064614 14:90951181-90951203 TTCAATATAAACTTGTAGGAAGG + Intronic
1122818137 14:104324280-104324302 GTGAATGTGAACATGCATGAGGG + Intergenic
1125955994 15:43791682-43791704 TTAAATGTGAACATGCAGCTTGG - Intronic
1126218462 15:46184451-46184473 TAAAATGTGAACAGGTAGAAAGG - Intergenic
1129679332 15:77649268-77649290 TTCAAAGTAAACATGTTGGGTGG + Intronic
1129949080 15:79570252-79570274 TTTAAAGTGAACATGTAGCCTGG - Intergenic
1131542740 15:93288571-93288593 TTTAAGGTGATCCTGTAGGAAGG + Intergenic
1133096583 16:3450964-3450986 GTCAATTAGAACATGCAGGAGGG + Intronic
1133661775 16:7925144-7925166 TTCCATCTGAAAATGCAGGAAGG - Intergenic
1134882958 16:17762162-17762184 CTCAATGTGATCATGTTGGGAGG + Intergenic
1135346351 16:21691972-21691994 TTCAATGTGAACCTTGAGTAGGG + Intronic
1136054564 16:27678784-27678806 CTCAAGGTGAACCTGAAGGAGGG + Intronic
1139362478 16:66409135-66409157 TTCAATGTTAACAGGAAGGAGGG + Intergenic
1140979413 16:80092506-80092528 TGCAATGGGAACATCAAGGATGG - Intergenic
1142204519 16:88776548-88776570 TCCTATGTGCACATCTAGGAGGG + Intronic
1142229453 16:88892985-88893007 TTCACTGTGAACAGGGAGCAAGG + Intronic
1144145038 17:12389245-12389267 TTCCATGGGATCATGTAGCAGGG - Intergenic
1145875452 17:28315729-28315751 TTGAATGAGAACATGAAGGCTGG - Intergenic
1149573936 17:57697929-57697951 TTCAAAGTGGGCATGAAGGAGGG - Intergenic
1153495326 18:5692559-5692581 TTCAAAGTGCATATGTAAGAAGG - Intergenic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1159662415 18:71114947-71114969 ATCTATGTTAACATGTGGGATGG - Intergenic
1164720369 19:30427525-30427547 GTCAATGTGAACTTGTTGGTTGG + Intronic
925273348 2:2631083-2631105 TTCATTGAGAACATGCAGAAAGG - Intergenic
926218757 2:10921499-10921521 TTCAATGTGAGCATTTAGAGAGG - Intergenic
927624888 2:24705112-24705134 TTCAATATGAATCTATAGGAGGG - Exonic
927656374 2:24950341-24950363 ATCAAGGTGAAAAAGTAGGAAGG + Intronic
927953917 2:27194475-27194497 TTTAAAGTGAACATCTAGGCTGG + Intergenic
928034582 2:27810042-27810064 TACACTGTGAAAATGAAGGAAGG + Intronic
928254816 2:29713012-29713034 TTCAAAGTTAATATGTAGGCAGG + Intronic
929973308 2:46605148-46605170 TTAAAAGTGAACATTTAAGAAGG + Intronic
930513302 2:52373599-52373621 TTGAAGCTGAAGATGTAGGATGG + Intergenic
930912830 2:56650638-56650660 TTCAATGTATACATTTTGGAAGG - Intergenic
933399932 2:81783113-81783135 ATCAATGTGAAAATGCAGGCCGG - Intergenic
938488606 2:131743186-131743208 GTCACTGTGAACATGGAGTAAGG + Intronic
938988680 2:136605586-136605608 TTCAAAGTGAAAAGGTAAGAGGG - Intergenic
940852460 2:158701579-158701601 TCCAATGTGACCTTCTAGGAAGG + Intergenic
940926098 2:159365168-159365190 TACAATGGGACCATGTAGAATGG + Intronic
944911496 2:204314842-204314864 TTGAATGTGAACAGGTTGGCAGG - Intergenic
947236641 2:227948500-227948522 TTAATTGTGGACATTTAGGAAGG + Intergenic
947974810 2:234356432-234356454 TCCTAAGTGAAAATGTAGGAAGG + Intergenic
948231769 2:236354416-236354438 TTCAATGGGAAGGTGTTGGATGG + Intronic
948683755 2:239658073-239658095 TTGAATGTGACCATCCAGGAAGG - Intergenic
948733920 2:239986263-239986285 TTCCATTTGAACTTGAAGGAAGG - Intronic
1169923009 20:10755464-10755486 TTCAATGTGAACTTTTGGCAGGG + Intergenic
1172321117 20:33995529-33995551 TTCAATGTGATCCGGTTGGAGGG + Intronic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1174741177 20:53015642-53015664 TTCTATGTTAAAATATAGGAGGG + Intronic
1175072764 20:56348173-56348195 TGAAATGTGAACATCAAGGAAGG + Intergenic
1177410890 21:20729178-20729200 TTTAATATGAACATGGAGAAAGG - Intergenic
1177565466 21:22815944-22815966 TTCAATGAAAACATTTAGGCTGG + Intergenic
1178018674 21:28382996-28383018 TGCATTGTGAACATGTCAGATGG + Intergenic
1179522992 21:41957334-41957356 CTCAAGGTGAGCATGCAGGAGGG - Intergenic
1181755944 22:25024905-25024927 TGCTCTGTGAACAGGTAGGAGGG + Intronic
1183583975 22:38741426-38741448 TCCGAGGTGAACATGTTGGATGG + Intronic
1184903894 22:47465772-47465794 TTGAATGTGAACATGTTGAGAGG + Intronic
1185337821 22:50278579-50278601 TACAATGTGAGCGTGTAGGCCGG - Exonic
951607512 3:24452384-24452406 TTTTATGTGAAAATGTTGGATGG - Intronic
953161542 3:40425119-40425141 TTAAATGTGAAGATGTAGGCTGG + Intronic
956769825 3:72515721-72515743 TTAAATGTGAACATTACGGAAGG + Intergenic
957824268 3:85420184-85420206 ATCAGTGTAAACATGTAGAATGG - Intronic
957877399 3:86165562-86165584 AGCAATGTGACCATGTAGGTTGG - Intergenic
959779794 3:110216492-110216514 TTTATTTTGAACATGTATGATGG - Intergenic
959920647 3:111864399-111864421 TTCAAAGTAAACATTTAGCAAGG + Intronic
962167552 3:133065149-133065171 TTCAATGTGTATTTGTTGGATGG + Intronic
962315701 3:134358356-134358378 CTCAATGTGAACATGAGGGATGG - Intronic
963277340 3:143345857-143345879 TCCAATCTGAACAAGTAGGAAGG + Intronic
965108878 3:164395228-164395250 ATAGGTGTGAACATGTAGGAAGG + Intergenic
966634319 3:182115322-182115344 TTGAATGTGCATATGTATGAGGG - Intergenic
968398153 4:262647-262669 TTTGATGTGTAAATGTAGGAGGG - Intergenic
969029857 4:4203234-4203256 TTGAATGTGGACATGAAGGCTGG + Intronic
970892306 4:21060917-21060939 TTGAATGTGAAAATGTTGTACGG + Intronic
971011088 4:22436147-22436169 TTCAATGTGAACTCGAAGGATGG + Intronic
971301521 4:25446098-25446120 TTCAGTGTGGAAATCTAGGAGGG + Intergenic
971714335 4:30155747-30155769 TTAAATATGAACATGTTGGTGGG - Intergenic
971782911 4:31060657-31060679 TTCAATTTCAACATATATGAAGG + Intronic
973041944 4:45478519-45478541 TTAAATATGAAAATTTAGGATGG - Intergenic
974256206 4:59458544-59458566 TACAGTGTGAAAATGTAGGGTGG - Intergenic
975489118 4:74969335-74969357 TTCTATTTTAACATGTAAGAAGG + Intronic
975768860 4:77699199-77699221 TTTAAAATGAACATGTATGAGGG + Intergenic
977921628 4:102650848-102650870 TTCACTGGCAACAAGTAGGATGG - Intronic
979278594 4:118839803-118839825 TGCCATGAGAACATGTAAGAAGG + Intergenic
981047482 4:140278686-140278708 TTCAATGTATACATTTTGGAGGG + Intronic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981884868 4:149662380-149662402 TTCCATGTGCAGATGTTGGATGG + Intergenic
983276615 4:165625325-165625347 TTCAATGTCAACATAGAGCAAGG - Intergenic
983711646 4:170724081-170724103 TTGTATGTGTACATGTAGGAGGG + Intergenic
986949615 5:13067213-13067235 TTCAATGGGAACATCTAAAATGG + Intergenic
987131290 5:14862333-14862355 TACAATGAAAACATTTAGGAGGG - Intronic
987652078 5:20754907-20754929 TAAAATGTAAACATGTATGATGG - Intergenic
988743484 5:34106574-34106596 TAAAATGTAAACATGTATGATGG + Intronic
990517274 5:56541973-56541995 TTCAATGTGAACTTATAGGTTGG + Intronic
992309742 5:75483504-75483526 ATCAATATGAACATATAAGAAGG + Intronic
992865559 5:80953843-80953865 TACAATGGGAAGATGTCGGAAGG + Intergenic
993099917 5:83525336-83525358 TTCTTTGTGAACATGCATGAAGG + Intronic
993918315 5:93768883-93768905 TTCATTATTAACATGTAGGGAGG - Intronic
996336476 5:122389019-122389041 TTCAATTTGCACTTGCAGGATGG - Intronic
996399479 5:123046209-123046231 TTGAATTTGAAAATGTAGCAGGG + Intergenic
997041366 5:130259029-130259051 TTAAATTTGAAAATGTAGTATGG + Intergenic
999595531 5:153199832-153199854 GTCAATGTGTATTTGTAGGAAGG + Intergenic
1000180059 5:158800314-158800336 TTATATGTGAACAAGTATGATGG + Intronic
1000408709 5:160916053-160916075 CTCAGTGGGAACATGGAGGAGGG - Intergenic
1002041898 5:176520785-176520807 TTCAATGGGAACTAGAAGGAAGG + Intergenic
1002173782 5:177390119-177390141 GTCAATGGGAACAGGTTGGAAGG - Intronic
1006541317 6:34742402-34742424 TTCAATTTACACATGTATGACGG + Intergenic
1007251002 6:40494947-40494969 TTCCAGGTGAGCATGAAGGAAGG - Intronic
1011354412 6:86459215-86459237 CTCAATGTGACCATCTAGGGAGG - Intergenic
1012820455 6:104080254-104080276 TGGAATGGGAACATGTGGGAAGG + Intergenic
1013024635 6:106258969-106258991 TTCAATGAGTACATGAAGAAAGG + Intronic
1015586508 6:134782180-134782202 GACAATGGAAACATGTAGGAAGG - Intergenic
1019018276 6:168896434-168896456 TGGAATGTGAACATGAGGGATGG - Intergenic
1021394532 7:20131111-20131133 TTCAACGTGAACTTGAGGGAGGG - Intergenic
1024047381 7:45593896-45593918 GTCTATGTGAACACGTAGGAGGG + Intronic
1024568023 7:50699689-50699711 TTCTATGTTAACATGTAAAACGG + Intronic
1027366850 7:77467630-77467652 TGCAATGGGATCATGTAAGACGG + Intergenic
1027432190 7:78125803-78125825 TTCACTGTGGACATGGAGAAAGG - Exonic
1030687521 7:112502571-112502593 TTCAGTGTGGAAATTTAGGATGG + Intergenic
1030822159 7:114107401-114107423 TTCAATGTGCACATGTAAAATGG - Intronic
1031443318 7:121820790-121820812 TACAATGTCGACATTTAGGAAGG + Intergenic
1031885328 7:127240340-127240362 TTTAATGAGAAAATGCAGGAAGG - Intronic
1032732247 7:134655315-134655337 AACAAGGTGAACATGAAGGAGGG - Intronic
1033396766 7:140981956-140981978 TTCAATGTGAAAATGCAGTCAGG - Intergenic
1034986620 7:155519825-155519847 TTCAGTGTGAATATGTGGGGTGG - Intronic
1040581297 8:48700676-48700698 TGCAATATGAACATGTGTGAGGG + Intergenic
1042572891 8:70185782-70185804 TTCTAAGTGAACATTTAGGGAGG + Intronic
1042904295 8:73757426-73757448 TTCAATGAGAAAATGAATGAAGG - Intronic
1045060418 8:98406057-98406079 TACAATGGGAACATAGAGGAGGG - Intronic
1046038958 8:108878945-108878967 TGCAATTTGAAAATGTAGCAGGG - Intergenic
1046508002 8:115161011-115161033 TTCAGTGTGAACATAGAGAAAGG - Intergenic
1047486529 8:125335847-125335869 TTCAAAGTGAATAGGTAGGTTGG + Intronic
1048458309 8:134598364-134598386 TTCAATGTGAACATGTAGGATGG - Intronic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1052055532 9:23902860-23902882 TTCAATGTCCAGAGGTAGGAGGG - Intergenic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1055946506 9:81695960-81695982 TGTTATGTGAATATGTAGGAAGG - Intergenic
1056084475 9:83132037-83132059 TTCTAGAAGAACATGTAGGATGG - Intergenic
1056668917 9:88606617-88606639 TTTAATGTGCACATGGAGAAAGG - Intergenic
1058546811 9:106069368-106069390 TTCAGTGAGAACAAGTAGGGTGG + Intergenic
1062433762 9:136537065-136537087 TCCCAGGTGAACCTGTAGGATGG - Intronic
1186623743 X:11269285-11269307 TTCCAAGTGAGAATGTAGGAAGG - Intronic
1192537780 X:71943048-71943070 TTCAGTGTGAAAATGGAAGAGGG - Intergenic
1192595866 X:72407626-72407648 TGCAATTTGAAAATGGAGGAAGG + Intronic
1197321710 X:125040235-125040257 ATGAATGTGAATATTTAGGAGGG - Intergenic
1198087161 X:133292622-133292644 TGCACTGTAAACATGTAGAATGG - Intergenic
1199558665 X:149138146-149138168 TGCAATGTGTACATCAAGGAAGG - Intergenic