ID: 1048459818

View in Genome Browser
Species Human (GRCh38)
Location 8:134612197-134612219
Sequence GCCTTTCTCAGCCATGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048459814_1048459818 20 Left 1048459814 8:134612154-134612176 CCTCAGAACATATGACAAATGCA 0: 1
1: 0
2: 2
3: 33
4: 324
Right 1048459818 8:134612197-134612219 GCCTTTCTCAGCCATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048459818 Original CRISPR GCCTTTCTCAGCCATGAGTG TGG Intronic
No off target data available for this crispr