ID: 1048459929

View in Genome Browser
Species Human (GRCh38)
Location 8:134613360-134613382
Sequence CCGCGTCCGGACTCTGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048459925_1048459929 13 Left 1048459925 8:134613324-134613346 CCACGCTCTGCAACGGATAAACT 0: 1
1: 0
2: 1
3: 5
4: 61
Right 1048459929 8:134613360-134613382 CCGCGTCCGGACTCTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048459929 Original CRISPR CCGCGTCCGGACTCTGCTTT AGG Intronic
No off target data available for this crispr