ID: 1048462895

View in Genome Browser
Species Human (GRCh38)
Location 8:134637469-134637491
Sequence CTGAATTTGGGTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048462895_1048462901 18 Left 1048462895 8:134637469-134637491 CCTTCCTCCTCACCCAAATTCAG 0: 1
1: 0
2: 4
3: 28
4: 419
Right 1048462901 8:134637510-134637532 CTTCCGCAGCTGGCGCGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 46
1048462895_1048462900 8 Left 1048462895 8:134637469-134637491 CCTTCCTCCTCACCCAAATTCAG 0: 1
1: 0
2: 4
3: 28
4: 419
Right 1048462900 8:134637500-134637522 TGCAGATGTGCTTCCGCAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048462895 Original CRISPR CTGAATTTGGGTGAGGAGGA AGG (reversed) Exonic
900578766 1:3397353-3397375 CTGTACTTGGGTGTGGAGGAAGG - Intronic
900849431 1:5130644-5130666 GGGAATATGGGAGAGGAGGATGG + Intergenic
900989052 1:6089599-6089621 CTGGGTTGGGGTGGGGAGGATGG - Intronic
901412374 1:9093401-9093423 CAGGATTTGGGTGAGGCGAAGGG - Intergenic
901910953 1:12457626-12457648 CTGCATTTGGAAGAAGAGGAAGG + Intronic
901916172 1:12502331-12502353 TGGAATCTGAGTGAGGAGGAGGG + Intronic
902116911 1:14128707-14128729 ATGAATTTGGGGGGTGAGGAGGG + Intergenic
902681043 1:18043870-18043892 CTGCATTGGAGTGGGGAGGATGG - Intergenic
903250702 1:22051493-22051515 ATAAATTTGGGGGAAGAGGAGGG + Intergenic
905432727 1:37936202-37936224 CTGAACTTGGGGGAAGAGGAGGG - Intronic
905908544 1:41638049-41638071 CTGAAGTTGGGAGAGTGGGAAGG + Intronic
906189755 1:43890329-43890351 CTGAATCTGGGTGATGGGGGTGG + Intronic
906195872 1:43930550-43930572 GTGAATTTGGGTAGGGGGGAGGG + Exonic
906345123 1:45010169-45010191 CTGGAATGGGGTGGGGAGGAAGG - Intronic
906518469 1:46453369-46453391 CTGCATTTGGAGGAGGATGAGGG - Intergenic
908149165 1:61282031-61282053 CCTAATTTGGGTGTGGGGGAAGG + Intronic
908536527 1:65083597-65083619 CTGAATTTGTGTTATGAGGGAGG - Intergenic
908947999 1:69523253-69523275 CTGAATGTGGGTGATTATGAAGG + Intergenic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
911023603 1:93413286-93413308 TTGAATTTGGGGGAGGGGGTTGG + Intergenic
911150686 1:94594723-94594745 CAGAGTTTGGGAAAGGAGGAAGG - Intergenic
911545491 1:99211336-99211358 CTGAGTTTGGGAGAGGGGAATGG - Intergenic
911965259 1:104360582-104360604 CTGCATTTGGGTAAAGATGAGGG + Intergenic
912688440 1:111785415-111785437 CTGACCTTGGGTGAAGAGGTAGG + Intronic
912998546 1:114556116-114556138 CTGAACTGGGGTGGGGAGGCTGG - Intergenic
913034204 1:114946628-114946650 TTGAAATTGGGAGAGGAGGGTGG + Intronic
913144112 1:115972470-115972492 ATGAATTTGGGTGAGGGGGCAGG - Intergenic
913248565 1:116892133-116892155 GTGAATTTGTGTGGGGGGGAGGG - Intergenic
914909237 1:151770816-151770838 CTTAAATTCTGTGAGGAGGAAGG + Intronic
915034827 1:152912840-152912862 CTGGGGTTGGGTGGGGAGGAAGG - Intergenic
915558163 1:156671228-156671250 CTGAATCTGAGGGAGCAGGATGG - Exonic
915566198 1:156714471-156714493 ATGAATTTGGGGGAGGTGGCTGG - Intergenic
915779826 1:158535088-158535110 CCGAAGTTTGGTGAGGACGAAGG - Intergenic
916144536 1:161727125-161727147 CGGAAGAGGGGTGAGGAGGAGGG - Intronic
916498357 1:165365414-165365436 CTGGAGTTGAGTGAGGAGGAGGG - Intergenic
917455494 1:175182434-175182456 CTGATTGTGGGTGAGGGGGCAGG - Intronic
918144483 1:181743492-181743514 CTGACTTTGGTTGGGGAGCAGGG - Intronic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
920382670 1:205544601-205544623 TTGAATTAGGATGAGGAAGAGGG - Intergenic
922645608 1:227283674-227283696 CAGTATTTGGGTGATGAGTACGG + Intronic
923748190 1:236722933-236722955 CTGGATTTGGGGTTGGAGGAGGG + Intronic
924261448 1:242235557-242235579 CAGGATTTGGGGGAGAAGGAGGG + Intronic
1063122339 10:3113786-3113808 CTGACATTAGGTGAGAAGGAAGG + Intronic
1064252669 10:13718663-13718685 CTGAATTGTGGGGAAGAGGAGGG + Intronic
1065512836 10:26496324-26496346 GTGGATTAGGGTCAGGAGGAGGG - Exonic
1067974144 10:51005186-51005208 ATCATTTTGGGGGAGGAGGAAGG + Intronic
1068987803 10:63123211-63123233 TTGTATTTTGGGGAGGAGGATGG - Intergenic
1071355530 10:84789847-84789869 CTGGATTTGGGCTTGGAGGAGGG + Intergenic
1072251777 10:93587371-93587393 CTGGATCAGGATGAGGAGGATGG - Exonic
1073082165 10:100867117-100867139 CTGAGGTTGGGTGCTGAGGAAGG - Intergenic
1073478429 10:103769932-103769954 CAGAATATGGGTGAGGAAAATGG - Intronic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1075070298 10:119315872-119315894 ATGAATTTGGAGGGGGAGGAAGG - Intronic
1075226426 10:120633685-120633707 CTGCCTGAGGGTGAGGAGGAAGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075920921 10:126211987-126212009 CAGAATGTGGGTGATGGGGAGGG + Intronic
1076204224 10:128582205-128582227 CTGAAGGTGGGAGAGAAGGAAGG + Intergenic
1076604277 10:131678975-131678997 CTGAACTTTGTTGAGGAGGGTGG + Intergenic
1076751381 10:132545191-132545213 CTGATTTTGGGGGAAGAGGCTGG + Intronic
1077007997 11:368254-368276 CAGAAGTTAGGGGAGGAGGATGG + Intergenic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1078412758 11:11141111-11141133 CAGAACTTGGGTGAGGAGATGGG + Intergenic
1078444536 11:11394366-11394388 TTCAATTTGGGAGAGGAGGTTGG + Intronic
1078946913 11:16078612-16078634 GTGACTTTGTGGGAGGAGGAAGG + Intronic
1079693861 11:23454245-23454267 GTTAATTTTGGTGAGGGGGATGG - Intergenic
1080437633 11:32260897-32260919 CAGAATTTGAGAGAGGAAGAGGG + Intergenic
1083491771 11:63019188-63019210 CTGAACTTGGATGTGGAGGGTGG + Intergenic
1084041787 11:66546820-66546842 CTAAATATGGGGGAGGAGGGAGG - Intronic
1084932959 11:72571400-72571422 TGGAGTTTGGATGAGGAGGACGG - Intergenic
1084968576 11:72757175-72757197 CTGGATTTGGCTGAGGAAGAGGG + Intronic
1085989536 11:81825260-81825282 CTGAAATAAGGTGAGGGGGAAGG + Intergenic
1086601109 11:88635004-88635026 CTGAATTTTGGTGGGGAGGAAGG + Intronic
1087333791 11:96817102-96817124 TGGAGTTTGGGTGAGGAAGATGG - Intergenic
1087764683 11:102137846-102137868 CTGATTTTTGGAGAGGTGGAAGG + Intronic
1087813280 11:102631599-102631621 ATGAATTTGGGTGGGGGGGGTGG - Intergenic
1088851677 11:113708441-113708463 CAGAGTTGGGGTGAGGGGGATGG - Intergenic
1090181915 11:124707274-124707296 CAGAATTTGGGTTGGGAAGAGGG - Intergenic
1091248573 11:134121852-134121874 CTGAATTTTGTTTGGGAGGAGGG - Intronic
1091727837 12:2857940-2857962 TTGAATTTGGGGTGGGAGGATGG - Exonic
1091864059 12:3815048-3815070 CTGTATCTGTGTGAAGAGGAAGG + Intronic
1092030191 12:5277410-5277432 CTGATTTCAGGGGAGGAGGAGGG + Intergenic
1092061177 12:5551809-5551831 CTGATTTTGGATTAGGAGTAGGG - Intronic
1092128741 12:6093675-6093697 CTGACTTGGGCTGAGGAGGTAGG - Intronic
1092782573 12:12001085-12001107 CTGAGTTTGCGTGAGGAGAGGGG - Intergenic
1093517978 12:20013449-20013471 TTATATTTGGGAGAGGAGGAAGG - Intergenic
1093542106 12:20299342-20299364 CAGAATTTGGGTGAAGGGGGAGG - Intergenic
1093783629 12:23166976-23166998 CTAAGTTTGGGTAAGGAGGTAGG + Intergenic
1095251686 12:39986250-39986272 ATGAATTGGGGTGGGGAGTAGGG + Intronic
1096500371 12:52060916-52060938 CTGAGGCTCGGTGAGGAGGAGGG - Intergenic
1097257792 12:57693903-57693925 CTGAAATTGGGGAACGAGGAGGG + Intergenic
1099924726 12:89003488-89003510 TAGAATTTGGGGGAGGAGGGTGG + Intergenic
1100410232 12:94310383-94310405 ATGAATGGGGGTGAGTAGGAGGG - Intronic
1100882541 12:99034954-99034976 CTCAGTTTGGGCGATGAGGAAGG + Intronic
1101417081 12:104517652-104517674 CTGAAGTAGGGTGAGGGTGATGG - Intronic
1101672188 12:106885823-106885845 GTGGATTTGGGTGGGGGGGAGGG + Intronic
1102097655 12:110253042-110253064 CTTAATTTGATTAAGGAGGAAGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102588740 12:113941706-113941728 CTCAAGATGGATGAGGAGGATGG - Intronic
1102869431 12:116402078-116402100 CTGGAGTGGGGTGGGGAGGAAGG + Intergenic
1103058103 12:117837264-117837286 CTGAGTCTGAGAGAGGAGGAGGG - Intronic
1103205408 12:119125158-119125180 CTGAATACGGGTGAGCAGAAAGG - Intronic
1103605394 12:122082133-122082155 CTGACTTTGGGTGTGGAACAGGG + Intronic
1103611270 12:122125663-122125685 TTGAACTTGGGAGAGAAGGAAGG + Intronic
1103736123 12:123061914-123061936 ATGGAGTTGGGTGCGGAGGAAGG + Intronic
1104986181 12:132598676-132598698 CTGACTGTGGGTGGAGAGGAGGG - Intergenic
1105782754 13:23718361-23718383 CTCGATTTGGGTGGGGAAGATGG + Intergenic
1106594583 13:31125461-31125483 GTAGATTTGGGTGAAGAGGAGGG - Intergenic
1106953652 13:34912043-34912065 ATGAATTTGGGTGGGGGGAAGGG + Intergenic
1107765594 13:43730825-43730847 CGGAATGAGGGTGAGGATGAAGG - Intronic
1108485134 13:50916120-50916142 TTTATTTTGGGTGAGGATGATGG - Intronic
1108563854 13:51674727-51674749 CTGTATGTGGGTGGGGAGGGTGG + Intronic
1108712584 13:53048524-53048546 CAGTCCTTGGGTGAGGAGGATGG + Intronic
1108866205 13:54925500-54925522 CTGAATTTGGGAGAGGAACCTGG + Intergenic
1110386760 13:74921265-74921287 CTGCATTTGGGAGACAAGGAAGG - Intergenic
1110503160 13:76252942-76252964 ATAAATTTGGGGGAGGAAGAAGG - Intergenic
1111262957 13:85766750-85766772 CTGAGTTTGGGTAGGGAGGGAGG + Intergenic
1113586772 13:111471218-111471240 GTGATTTGGGGTGAGGGGGAGGG - Intergenic
1113629594 13:111873126-111873148 CTGAATTGGGGTGCTGGGGATGG + Intergenic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1114316416 14:21513723-21513745 ATAAATTGAGGTGAGGAGGAAGG + Intergenic
1115052046 14:29074442-29074464 CTGAATTTTGATGAGGAGACAGG - Intergenic
1115474191 14:33798604-33798626 CTGAAGCTGGGTCTGGAGGAAGG - Intronic
1115632050 14:35255008-35255030 CAGACTGTGGGTGAGGAGGGTGG - Intronic
1115633676 14:35270028-35270050 TTGAATTTGGGTGAAGAGAGAGG + Intronic
1115831360 14:37346040-37346062 CTGAATGTGGATGAGCACGATGG + Intronic
1116802140 14:49454142-49454164 GTGAAGATGGGTGAGGAGGAAGG - Intergenic
1117327958 14:54686173-54686195 CTGAATGTGGGTGAGGGAGTGGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1118350041 14:64967186-64967208 CTCCTTCTGGGTGAGGAGGAGGG - Intronic
1118733913 14:68688963-68688985 CTGAGCATGGCTGAGGAGGAGGG + Intronic
1119642632 14:76326731-76326753 CTGAAATTGGGAGAGGAGGAGGG - Intronic
1119866936 14:77981706-77981728 CTGATTTTGGGTGAGGATGAGGG + Intergenic
1120059337 14:79963773-79963795 TTGGATTTGGAGGAGGAGGAGGG - Intergenic
1120597721 14:86461965-86461987 AAGATTTTGGGTGAGGAGGCAGG - Intergenic
1120857152 14:89222673-89222695 GTGAATTTGGGTGGGAAGGTGGG - Intronic
1121233812 14:92377864-92377886 CTGAATGAAGGTGAGGAAGAAGG + Intronic
1121303482 14:92890213-92890235 CTGAAGCTGGGTGCTGAGGAGGG - Intergenic
1121555394 14:94832519-94832541 CTGAATTTAAGAGACGAGGATGG + Intergenic
1121658459 14:95616191-95616213 CTGAATTTTGATGAGGGGAAGGG - Intergenic
1124471318 15:29988831-29988853 GTGGATTTGAGTGAGGAGCAGGG + Intergenic
1125478291 15:40062557-40062579 CAGACTTAGGCTGAGGAGGAAGG + Intergenic
1125536989 15:40446782-40446804 CTGTCTTTGGGTAAGGAGGATGG + Intronic
1126267871 15:46775764-46775786 CTGCATTTGGGGGAGGGGAAGGG - Intergenic
1127246371 15:57179796-57179818 ATTAATTTGGGGGAGGAAGAAGG - Intronic
1128520071 15:68369369-68369391 GTGAAGTTGGGTGGGGAGGGTGG + Intronic
1128820771 15:70650866-70650888 CTTAATATGGGAGAGGAGAATGG - Intergenic
1129156442 15:73721287-73721309 CAGGATTTGTGTGGGGAGGATGG + Intergenic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1130335754 15:82955892-82955914 CTAATTTAGGTTGAGGAGGATGG + Intronic
1130843396 15:87722855-87722877 CTGAGACAGGGTGAGGAGGATGG + Intergenic
1130874383 15:87999737-87999759 CTGAATTCAGATGAGGAAGATGG + Intronic
1130942272 15:88521081-88521103 CTGATTTGGGGTGGGGAGGTAGG - Intronic
1130959815 15:88652360-88652382 ATGGAGATGGGTGAGGAGGAGGG - Intronic
1131485773 15:92819333-92819355 CTGAATATGGCTGAGAAGCATGG + Intergenic
1131537679 15:93251471-93251493 ATGAATTGGGGTGGGGAGGGAGG - Intergenic
1131558015 15:93415879-93415901 TGGAATTGGAGTGAGGAGGAAGG + Intergenic
1131804649 15:96108921-96108943 CGGACTTGGGGTGAGGGGGATGG - Intergenic
1131868290 15:96734848-96734870 CTGATTTTAGGTGGGGAGTAAGG + Intergenic
1131988046 15:98064880-98064902 CTCAATTTGGGAGCTGAGGAAGG - Intergenic
1132116297 15:99138687-99138709 CAGGACATGGGTGAGGAGGATGG + Intronic
1133206658 16:4238171-4238193 CTGGATTTGGGTTTGGAGCAGGG + Intronic
1133738247 16:8631914-8631936 CTGCATAGGGGTGAGGAAGAAGG - Intronic
1134034861 16:11022019-11022041 CTGAATTTTGGTGGAGAGAAGGG + Intronic
1135774912 16:25249120-25249142 CAGAAGCTGGGGGAGGAGGAGGG + Intronic
1135832259 16:25786033-25786055 TTGAATTTGGGTGGGGAAGTAGG + Intronic
1136179092 16:28538745-28538767 CTGATTTCGGGAGAGGAGGAAGG + Intronic
1136490263 16:30603426-30603448 CTGAATTTGGGGGAGCTGCATGG - Exonic
1136527443 16:30841253-30841275 ATGAATTGGGGTGAGGGGGCAGG - Intronic
1136922677 16:34345258-34345280 CTTATTTGGGGTGAGAAGGAGGG - Intergenic
1136981896 16:35066548-35066570 CTTATTTGGGGTGAGAAGGAGGG + Intergenic
1137764196 16:50965232-50965254 CTGAGTTTGGGAGAAGTGGAGGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1138257335 16:55577734-55577756 CTGAATATGGTTTAGGAGGAGGG - Intronic
1139185148 16:64797549-64797571 CTAAAAGTGGGTGGGGAGGACGG - Intergenic
1140622231 16:76749117-76749139 TGGAATTTGGGAGAGGAGGATGG - Intergenic
1141317063 16:82972307-82972329 CTGTGTTTGGGTGAGAAGCAGGG + Intronic
1142747969 17:1969652-1969674 CAGAATTTGAGTGAGGTGGCTGG + Intronic
1143849182 17:9796826-9796848 CTGGAATAGAGTGAGGAGGAAGG + Intronic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1143959888 17:10707909-10707931 CTGAATTTGGGTTTGCAGCATGG + Intronic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1145280436 17:21463720-21463742 GTGAGTCTGGGTGAGGAGCAGGG - Intergenic
1145286891 17:21512541-21512563 TAGAATTTGGGAGAGGAGAAGGG + Intergenic
1145390727 17:22453799-22453821 TAGAATTTGGGAGAGGAGAAGGG - Intergenic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146687171 17:34848933-34848955 AAGAATTGGGGTGAGAAGGAGGG + Intergenic
1146987355 17:37232916-37232938 TTGAGTTTGGGTGAATAGGATGG - Intronic
1148011971 17:44489790-44489812 CTCAATTTTGGTGGGGAGGTGGG - Intronic
1148351880 17:46947101-46947123 CTGGAGGTGGGTGTGGAGGAAGG + Intronic
1148783084 17:50132465-50132487 CTTAATCTGGGTGGGGAGGCAGG - Intergenic
1149544054 17:57489919-57489941 AGGAATTAGGGTGAGCAGGAGGG + Intronic
1150102335 17:62434495-62434517 ATGAAAATGGGAGAGGAGGAAGG - Intronic
1151108823 17:71651452-71651474 CAGAATTTGGGTGTTGAGTAAGG + Intergenic
1151575555 17:74951120-74951142 CTGGCTTTGGGTTAGGAGGCTGG + Exonic
1154504643 18:15023656-15023678 CTGAATTATGGAGAGGAGGTGGG - Intergenic
1155406731 18:25496759-25496781 GTGAATTTGAGAGAGAAGGAGGG + Intergenic
1155532017 18:26776991-26777013 TTGAATTTGGGTAGGGAGGGAGG + Intergenic
1155926771 18:31664138-31664160 TTGAACTTGGGTCAGTAGGAAGG - Intronic
1157075671 18:44464723-44464745 CGGAATGTGGGAGAAGAGGATGG - Intergenic
1157181942 18:45505936-45505958 CAGAACTAGGGTGGGGAGGAAGG + Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1157977633 18:52343523-52343545 TTGATGTTGGGGGAGGAGGATGG + Intronic
1158014673 18:52770169-52770191 ATGAAGTTGGCTGGGGAGGAAGG - Intronic
1158752321 18:60276846-60276868 CTGAATCTGGTTGAAGAGTATGG + Intergenic
1160275776 18:77433662-77433684 CTGACGTGGGGTGAGGGGGAGGG - Intergenic
1160677511 19:399351-399373 GTGACTTTGGGAGATGAGGAAGG + Intergenic
1163250947 19:16126017-16126039 CTGGCTTTGGGAGGGGAGGAGGG - Intronic
1163633225 19:18427448-18427470 CGGAGTGTGGGTGAGGAGGGAGG - Intronic
1164775296 19:30848432-30848454 CTCAATTTGGGAGAGGTTGAAGG - Intergenic
1166225393 19:41392018-41392040 GGGAATTTGGGTGAGGCGTATGG - Intronic
1168325667 19:55537321-55537343 CTGAGTCTGAGGGAGGAGGAGGG - Intergenic
1168627942 19:57933850-57933872 CTGTGTTTGAGGGAGGAGGAAGG - Exonic
925420651 2:3708106-3708128 CTGAATTTCTGTGAGCAGGAGGG + Intronic
925639666 2:5975236-5975258 GTGAATTTGTGTAATGAGGATGG + Intergenic
925836847 2:7954466-7954488 CTCAATTTTACTGAGGAGGAAGG - Intergenic
925872428 2:8282757-8282779 CTGTATTTGGGTGGGCAGGCAGG - Intergenic
927149603 2:20188040-20188062 GAGAATTTGGGTGGGGAGGAGGG + Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
928125974 2:28616510-28616532 CTGATTTTGGGTGTGGTGCATGG + Intronic
928230904 2:29498251-29498273 CTGGGTTTGGGGGAGGAGGTTGG + Intronic
928314988 2:30238025-30238047 TTGAATTAGGGTAAGGAAGAAGG - Intronic
928366122 2:30704843-30704865 CTGAATCTGGGAGAGGCAGAGGG - Intergenic
929805448 2:45140865-45140887 CTGCACTTGGGTGTGGAGCATGG + Intergenic
930411573 2:51031949-51031971 CTCAATTTGGGTTGGGGGGAGGG - Intronic
930739574 2:54816825-54816847 CTGCATTTGGGACTGGAGGAAGG + Exonic
930774756 2:55160908-55160930 CTGATGCTGGATGAGGAGGAAGG - Intergenic
931259042 2:60600658-60600680 CTTACTGTGAGTGAGGAGGAGGG - Intergenic
935619756 2:105118487-105118509 TTGAATTTAGTTGAGGAAGATGG + Intergenic
935668454 2:105534970-105534992 CTGATTATGGATGAGGTGGAGGG - Intergenic
935934918 2:108171228-108171250 TTGAATGTGCTTGAGGAGGAAGG - Intergenic
936238232 2:110764642-110764664 GTGAATTTGGGTGATAATGATGG + Intronic
936674854 2:114702984-114703006 CTGTATTAGGGTGAGCAGGGTGG + Intronic
936862646 2:117036021-117036043 CTGAATATGAGTGATGAGAATGG - Intergenic
937912029 2:127080419-127080441 CAGGAGTTGGGTGAGGAGGAGGG + Intronic
938020980 2:127905620-127905642 GTGAATTTGGGTGGGGAGGCAGG + Intergenic
938617475 2:133014059-133014081 CTGCTATTGGGTGAGGATGATGG - Intronic
938638787 2:133258289-133258311 TTGGATTTGAGTGAGGAGCAAGG - Intronic
939664553 2:144934876-144934898 CTGAAATGAGGAGAGGAGGAGGG + Intergenic
940214145 2:151287543-151287565 TTAAGTTTGGGAGAGGAGGAAGG - Intronic
940567748 2:155389423-155389445 GTGAATATGTGGGAGGAGGAAGG + Intergenic
941355608 2:164487635-164487657 CTAAATTTTGGTGTGGAGTATGG + Intergenic
941415974 2:165221911-165221933 CTGAATTTGGGTCATGGAGAGGG - Intergenic
941716348 2:168767714-168767736 CTCAAGTTGGGAGAGGTGGAGGG + Intronic
942325660 2:174775002-174775024 CTAATTACGGGTGAGGAGGATGG + Intergenic
943531920 2:189093140-189093162 CAGAATGTGGGTTAGGAGAAGGG - Intronic
944154359 2:196594314-196594336 CTCATTGTGGGTGAGGGGGAAGG - Intergenic
944623612 2:201545735-201545757 GTAAATTTGGGTGTGGAGGAAGG - Intronic
944795016 2:203175257-203175279 CTGAAGTTGGATGTGGAGGGTGG - Exonic
945046959 2:205790060-205790082 CTGAGTTTGAGTGAGTGGGAAGG - Intronic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945882277 2:215338206-215338228 CAAAATTTGGGAGAGGAAGATGG + Intronic
947728831 2:232417149-232417171 CTGGTTTAGGGTGGGGAGGATGG - Intergenic
948080978 2:235204932-235204954 GTGAATTGGGATGAGGAAGAAGG - Intergenic
1168830590 20:843287-843309 CTGGATTGGGGTGGGGAGGCAGG - Intronic
1171262720 20:23747973-23747995 CAGAGCCTGGGTGAGGAGGATGG + Intronic
1172102145 20:32491389-32491411 CTTGATTTGGCTGAGGTGGAAGG - Intronic
1173059281 20:39646212-39646234 ATGAATTGAGGTGAGGAAGAAGG - Intergenic
1173157593 20:40627691-40627713 CTGACTTAGGGTGAGCAGGGGGG + Intergenic
1173226483 20:41165177-41165199 CTAAACCTGGGTGAGGAGGTGGG + Intronic
1173417097 20:42866367-42866389 CTGGATTTGGGTGTGGAGTCAGG - Intronic
1173539965 20:43843869-43843891 CAGAGTGTGGGTGAAGAGGAAGG + Intergenic
1173857646 20:46260977-46260999 AGGAATTTGGGGGAGGAGGCAGG - Intronic
1173911046 20:46671241-46671263 CCAAATTGGGGTGAGGAGGCTGG - Intronic
1174376551 20:50129979-50130001 CTGCCTTGGGGTGGGGAGGAAGG - Intronic
1174548357 20:51343422-51343444 CTGGAGCAGGGTGAGGAGGAAGG + Intergenic
1174941054 20:54927861-54927883 CAGCACTTGGGTGAGTAGGAGGG - Intergenic
1175220742 20:57415086-57415108 CTGACTTTGGCTGAGGAAGGTGG - Intergenic
1175857417 20:62129762-62129784 CTGAATTGAGGAGGGGAGGAGGG - Intronic
1176230481 20:64030205-64030227 CTGAGTGTGGGTCAGGAGGCTGG + Intronic
1177181930 21:17753708-17753730 CTCAGTTTGGGGGAGGAAGAGGG - Intergenic
1177529214 21:22338637-22338659 CTTATTTTGGGGGATGAGGAGGG - Intergenic
1179182155 21:39054698-39054720 CTGAAGATGGGAGAGGAAGAAGG - Intergenic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179624760 21:42642644-42642666 CTGAATTTGGGTGGGGCCCAGGG + Intergenic
1179800805 21:43810750-43810772 CTTACTGTGGGTGAGGAGTAGGG + Intergenic
1181779578 22:25183038-25183060 CTTAATTTGGGTGAGGAAAGAGG + Intronic
1184135000 22:42542893-42542915 CTGAATTTGGGGGGGGTGGGGGG + Intergenic
1184361030 22:44018784-44018806 GAGAATCTGGGTGAGGAGAACGG - Intronic
1184942260 22:47777625-47777647 CTGAATGGGGGTGAGGAGAGGGG + Intergenic
950602376 3:14045970-14045992 CTGCATTTGCTTGAGGGGGAGGG + Intronic
950789995 3:15463977-15463999 TTGAAATAGGGAGAGGAGGAAGG - Intronic
951932229 3:27981503-27981525 CTTTATTTGGGAGAAGAGGATGG - Intergenic
953943241 3:47121077-47121099 CTGAATTTGGGTGACCCAGAGGG + Exonic
954405136 3:50341239-50341261 TTCACTTGGGGTGAGGAGGAGGG + Exonic
954464594 3:50647032-50647054 CTGAGTCTGGGAGAAGAGGATGG + Intronic
954614981 3:51964829-51964851 CTACAGTTGGGAGAGGAGGAGGG + Intronic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955158008 3:56436475-56436497 GTGTATTTGGGAGAGGGGGAAGG - Intronic
955421602 3:58743746-58743768 CTGATTTTGGCTGAGTAAGATGG - Intronic
955496854 3:59542462-59542484 CTTAGATTGGGTGGGGAGGAAGG + Intergenic
955651240 3:61196543-61196565 CTGAATTGGGCTGAGGATGGTGG + Intronic
956361262 3:68450286-68450308 CAGATTTAGGGTGAGGAGAATGG + Intronic
957278213 3:78116177-78116199 CTGTATTTGGCTGATGAGGGAGG + Intergenic
957299943 3:78379021-78379043 CTGATTCTGGCTGAGGAGAATGG - Intergenic
957400725 3:79709699-79709721 TTGAATTTGGGGCAGGCGGAGGG - Intronic
957538816 3:81541456-81541478 ATGAATTTGGGCGAGGTGGCGGG - Intronic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
959371900 3:105537457-105537479 CTGCAATTGGGGGAGGGGGAAGG - Intronic
959841389 3:110980583-110980605 CTGAAGATAGGTTAGGAGGATGG + Intergenic
960997144 3:123347753-123347775 GTGAAGCTGGGGGAGGAGGATGG - Intronic
961109077 3:124268442-124268464 GTGAACTGGGGTCAGGAGGAGGG + Intronic
961345369 3:126260398-126260420 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961345384 3:126260457-126260479 TTGGATTAGGGTTAGGAGGAGGG - Intergenic
961422138 3:126814860-126814882 CTGAAGTGGGGTGAGGGGGATGG + Intronic
961511267 3:127405228-127405250 CTCACCTTGGGTGAGTAGGAAGG + Intergenic
962168486 3:133076071-133076093 CGAGATTTGGGTAAGGAGGAAGG + Intronic
962595893 3:136943029-136943051 CTGACTTGGGGTGTGGGGGATGG + Intronic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963173582 3:142275941-142275963 CTGGATTTGGGAGGCGAGGAAGG + Intergenic
964086975 3:152830778-152830800 CTGAAGTTGAGTGAGGAAAAAGG - Intergenic
966563896 3:181354447-181354469 CTAAATTTGAGTCAGGATGAAGG + Intergenic
966940061 3:184740664-184740686 CTGTGTTTGGGGGAGGAAGAGGG - Intergenic
967102386 3:186226467-186226489 CTGAACTTGGGTGGGGAGAGGGG - Intronic
967275360 3:187768800-187768822 ATCAATTTGGATGAGGTGGAAGG + Intergenic
968251437 3:197219556-197219578 GTGAATTTTGGTGGGGAGGGCGG - Intronic
971823100 4:31585105-31585127 AGGAATTTGGGTGGGGTGGAGGG + Intergenic
971956678 4:33429607-33429629 CTGGTTTAGGGTGAGGAGAAGGG + Intergenic
972109350 4:35537348-35537370 CTGAATTAAAGTGAGGAGGAAGG - Intergenic
972738932 4:41873062-41873084 CTGAATTTGGGTCAGAAAGTGGG - Intergenic
973561891 4:52145139-52145161 TTGAATTTGGGCAGGGAGGAAGG + Intergenic
974467418 4:62274695-62274717 CTAAATTTGGGGGAAGAGGCTGG - Intergenic
974667725 4:64986815-64986837 CTGAACTTGGATGAGGAAGAGGG - Intergenic
975257752 4:72257594-72257616 CTGAATTTGTGTGAAGAAGGAGG - Intergenic
975387594 4:73775619-73775641 CTGAATTTTGGTGAGGATATGGG + Intergenic
976205315 4:82618583-82618605 CTGGATGTGGGTGATGAGGAAGG + Intergenic
978008530 4:103650214-103650236 CTGGAGCTGGGTGAGGTGGATGG + Intronic
979057334 4:116013935-116013957 CTGACATTGGGTGGGGGGGAGGG - Intergenic
979200117 4:117967617-117967639 CTAAAGTGGGTTGAGGAGGAAGG + Intergenic
980127531 4:128788055-128788077 ATGAAGTTGGGGGAGGAGAAAGG - Intergenic
980208814 4:129758218-129758240 TTAAATCTAGGTGAGGAGGAAGG - Intergenic
981021130 4:140030174-140030196 CTGAAAATGGGAGGGGAGGAGGG - Intronic
981456018 4:144954086-144954108 CCGAATTTGGGGCATGAGGAAGG + Intergenic
982081816 4:151797646-151797668 CTTAAATTTGGTGGGGAGGAGGG - Intergenic
983112759 4:163773219-163773241 CAGAAATGGGGAGAGGAGGAAGG + Intronic
983163274 4:164444110-164444132 CTGAATGAGGGTGAAGGGGAAGG - Intergenic
983519548 4:168693006-168693028 ATAAATTTGGATGAGGAGGGAGG + Intronic
983555575 4:169056335-169056357 CTGAATTATGTTGAGCAGGATGG + Intergenic
984471760 4:180184490-180184512 CTGAATTTGGTTGTGGTGGTGGG + Intergenic
984501675 4:180565961-180565983 GTGAGTGTGGGTGAGCAGGAGGG + Intergenic
984624883 4:181996007-181996029 TTGAGTTTGCCTGAGGAGGAGGG - Intergenic
984961251 4:185100460-185100482 CTGAAGTTGAGTGTGGAGGTCGG - Intergenic
985721354 5:1490941-1490963 CTGAACTGGGGTGGGGAGGTGGG - Intronic
986248392 5:6031895-6031917 CTGCATATGGGTGGTGAGGACGG + Intergenic
987961470 5:24814585-24814607 CTGAATTTGGATGAGGAAGAGGG + Intergenic
989324035 5:40169341-40169363 CAGAATTTGGTTCAGGATGATGG - Intergenic
990927069 5:61038041-61038063 CTGAATATGGGTGATGAGACGGG + Intronic
991636506 5:68711289-68711311 CAGATTCTGGGGGAGGAGGAGGG - Intergenic
991977110 5:72194272-72194294 CCCAATGTGGGTGAGCAGGATGG - Exonic
994097521 5:95860321-95860343 CTGCATTTGGGTGAGGACTGAGG + Intergenic
995423601 5:111993848-111993870 ATAAATTTGGGAGTGGAGGAAGG - Intronic
996228270 5:121029301-121029323 CAGAATTTAGTTGAGGATGAAGG + Intergenic
996661106 5:126003756-126003778 CAGGTTTTGGGGGAGGAGGAGGG - Intergenic
997383483 5:133454448-133454470 CCGAAGTTGTGTGTGGAGGAAGG - Intronic
1001180527 5:169515703-169515725 ATGAATTTGGGCGAGGAGGGAGG + Intergenic
1003238313 6:4318360-4318382 CTGAAGTGGGGTGAGGAGTCAGG + Intergenic
1003870152 6:10396099-10396121 CTGAGGTGGGGTGGGGAGGATGG - Intronic
1005197120 6:23300477-23300499 CTGAAATTGAGAGAGGAGGAAGG + Intergenic
1005688293 6:28276792-28276814 CTGATGGTGGGTGAGGAGTAAGG - Exonic
1005883795 6:30079540-30079562 CTGAATTAGGGTGTGTAAGAAGG + Intergenic
1006195586 6:32239812-32239834 CTCAGTTTGGGTGCTGAGGAAGG + Intergenic
1006457539 6:34140591-34140613 CTGGCTCTGGGAGAGGAGGAAGG - Intronic
1006954157 6:37852197-37852219 CTCCATGGGGGTGAGGAGGATGG + Intronic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007699409 6:43758062-43758084 CAGAGTTGGGGTGAGGAGTAGGG - Intergenic
1008828041 6:55722561-55722583 CTGAATCTGGCTGAGGAAAAGGG - Intergenic
1009825609 6:68862132-68862154 CTGAATTGGGGTGGGGGGGGGGG - Intronic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1011551970 6:88538326-88538348 CTGAATGTGGGAGAGGAGGGAGG + Intergenic
1012226578 6:96710417-96710439 CTGAAGTTGGGTGAGGGGTCTGG + Intergenic
1012351226 6:98253075-98253097 GTGATTTGGGGTGAAGAGGAAGG - Intergenic
1013175527 6:107673469-107673491 CTGAGTTCGGCTGAGGGGGAAGG - Intergenic
1013440674 6:110163574-110163596 ATGAATTTGGGGGTGGGGGATGG + Intronic
1013948962 6:115756262-115756284 TTCAATTTGGGGAAGGAGGAAGG + Intergenic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1016223033 6:141699174-141699196 CTGTAGTTTGGTGAGGGGGAGGG - Intergenic
1019093042 6:169555948-169555970 CTGATTTTGGGTGGGGAGAAAGG - Intronic
1019637911 7:2086231-2086253 ATGCATTTTGGGGAGGAGGACGG - Intronic
1021752783 7:23820669-23820691 GAGAATGTGGGTGAGGTGGAAGG - Intronic
1022269101 7:28788245-28788267 CACAACTTGGGGGAGGAGGAGGG - Intronic
1022442543 7:30446128-30446150 CTGAGGTTGGGTGAGTAGAAGGG - Exonic
1022796510 7:33735665-33735687 CTGAGTGTCAGTGAGGAGGATGG - Intergenic
1023139303 7:37085042-37085064 CTGATTTTGGCTGGGCAGGATGG - Intronic
1023862537 7:44225031-44225053 CTGAGCTTGGCTGGGGAGGAGGG - Intronic
1026965032 7:74434084-74434106 CTGAGGCTGGCTGAGGAGGAAGG + Intergenic
1029467530 7:100735808-100735830 CAGAATGTGGGTTCGGAGGAGGG - Intronic
1030231009 7:107208597-107208619 TTGGATTTGGGTGAGGAGTTTGG - Intronic
1030523054 7:110621780-110621802 CTGAATGTGGGTCACTAGGATGG + Intergenic
1031205443 7:118751326-118751348 CTTAATTTGTGTGAAAAGGAAGG - Intergenic
1032155800 7:129466656-129466678 CTGGATTTGGGAGAGCAGAATGG + Intronic
1032931963 7:136682684-136682706 CTGACTTTGGGTGATAATGATGG + Intergenic
1033158219 7:138974287-138974309 CTGGATCTCGGTGAGGTGGAGGG + Intronic
1033242088 7:139688757-139688779 CTGGATTTTGGTGAGGTGGGAGG - Intronic
1033958436 7:146881506-146881528 TTTATTTTGGGTGAGGAGGTGGG + Intronic
1035259268 7:157651147-157651169 ATGAATTTTGCTGAGGAGGGAGG - Intronic
1036654265 8:10666086-10666108 CTGAAGATGGGTGATGATGATGG + Intronic
1037637966 8:20717521-20717543 CTGCATTTGTGTGTGAAGGAGGG + Intergenic
1037802043 8:22041187-22041209 CTGAGCTTGTGTGGGGAGGATGG - Intergenic
1037877229 8:22554175-22554197 GGGAGCTTGGGTGAGGAGGAGGG - Intronic
1038660683 8:29494057-29494079 CTGCATTTGAATGAGGAGAAAGG - Intergenic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039554440 8:38466688-38466710 TTTAATTTGGGGGAGGGGGAGGG + Intronic
1040459319 8:47632025-47632047 CTGCATTTGGGTGCTGGGGAGGG - Intronic
1040851954 8:51909984-51910006 ATGAATTTGGGTGGGGAGGGAGG + Intergenic
1041574459 8:59378114-59378136 CTGAATTAGGGTTAGGATCATGG + Intergenic
1041599166 8:59695214-59695236 CTGAAAATGGGTAAGGTGGAAGG + Intergenic
1042454961 8:68990102-68990124 ATGACTTTGGTTGAGGAAGAGGG + Intergenic
1043561948 8:81503357-81503379 GGGAATTTGGGTGAAGGGGATGG - Intergenic
1044841933 8:96344345-96344367 GAGAATTTGGGTGTGGTGGAAGG - Intergenic
1045451545 8:102331760-102331782 ATGAATTAGGGAGAGAAGGATGG - Intronic
1047218562 8:122899666-122899688 GTGGAATTGGGTTAGGAGGAGGG - Intronic
1047359906 8:124159757-124159779 CTGATTTTTGGTAAGGAGGTTGG - Intergenic
1047468341 8:125141927-125141949 CTGAACTTGGGGGAGGGGTATGG + Intronic
1047796014 8:128256752-128256774 CAGAGTGTGGGTGTGGAGGAGGG + Intergenic
1048301436 8:133254167-133254189 CAGAAGTTGCCTGAGGAGGAGGG + Intronic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1048841750 8:138572754-138572776 CTGAGTCCAGGTGAGGAGGAAGG - Intergenic
1048980099 8:139698628-139698650 CTGGCCTTGAGTGAGGAGGAGGG - Intronic
1049200317 8:141336884-141336906 CTGAATGGAGGTGAGGACGAGGG + Intergenic
1049218487 8:141418257-141418279 GTGATTTTGGGGGAGGAGGCTGG - Intronic
1051675443 9:19553951-19553973 ATGAATTTGGGTGGGGGAGAAGG - Intronic
1051974587 9:22934091-22934113 CTGAAGTGGGGGGATGAGGAGGG + Intergenic
1052403818 9:28033884-28033906 CTGGACTTGGGTGTGGGGGATGG - Intronic
1053294462 9:36902948-36902970 CTGGATTTGGGGGAAGGGGAGGG - Intronic
1054838883 9:69713589-69713611 CTGAATTTGAGAGGGAAGGAAGG + Intronic
1055240685 9:74182826-74182848 CACAATTTGGGTGGCGAGGAAGG - Intergenic
1056194330 9:84214772-84214794 CTGACTTTGAGGGTGGAGGAAGG - Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1058804346 9:108576819-108576841 TTGAATTTGGGAGAGCATGAAGG - Intergenic
1058950443 9:109898747-109898769 CCAAATATGGGGGAGGAGGAAGG - Intronic
1061015157 9:127977204-127977226 CTGAATGGGGCTGAGGAGGGAGG - Intronic
1061702283 9:132424857-132424879 CCGTGTTTGGGAGAGGAGGAGGG - Intronic
1062347626 9:136122705-136122727 GTGGCTTTGTGTGAGGAGGAAGG - Intergenic
1062685836 9:137812795-137812817 GTGAATGTGGGAGAGGAGGAAGG + Intronic
1186431672 X:9510376-9510398 AAGAAGTTGGGTGGGGAGGAGGG + Intronic
1187283854 X:17883968-17883990 TTAAATTTTGGTGAGGAGCATGG + Intergenic
1188360759 X:29250340-29250362 ATGAACTTGAGTGAGTAGGATGG + Intronic
1188562997 X:31491227-31491249 TTGGATTTGGGGTAGGAGGAAGG + Intronic
1190218721 X:48496981-48497003 CTGGAGTGAGGTGAGGAGGAAGG + Intergenic
1190630899 X:52384847-52384869 CTGTTGTTGGGTGGGGAGGAGGG + Intergenic
1191116888 X:56861754-56861776 GTGATTGTGGGTGTGGAGGATGG - Intergenic
1191179025 X:57539851-57539873 CTAAAATTGAGTGAGGGGGAAGG + Intergenic
1192393258 X:70753186-70753208 CGGAATTTGGGTGGGGGGGGTGG + Intronic
1192890483 X:75385262-75385284 CTGAATTCTGATGAGGAGAAGGG + Intronic
1196145081 X:112307645-112307667 CTGAATTTGGGTGAGATGAATGG - Intergenic
1197276933 X:124490226-124490248 ATGTCTTTGGGTGAGGTGGAGGG + Intronic
1198334248 X:135651603-135651625 AGGAATCTGGCTGAGGAGGAAGG + Intergenic
1198440295 X:136656749-136656771 GTGAAGATGGGTTAGGAGGAGGG - Intronic
1199030367 X:142990992-142991014 CTCCATTTGGGTGATAAGGAAGG + Intergenic
1199886561 X:152026918-152026940 CTGAACTCGTGGGAGGAGGACGG - Intergenic
1199968741 X:152842920-152842942 GTGAATTTAGGTGAGTAGGCAGG + Intronic
1199979044 X:152911061-152911083 CTGAGGTTGGGGGAGGAGCAGGG + Intergenic