ID: 1048463653

View in Genome Browser
Species Human (GRCh38)
Location 8:134643719-134643741
Sequence ACAAACATAAAACGTGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048463653_1048463661 25 Left 1048463653 8:134643719-134643741 CCCTGAGCACGTTTTATGTTTGT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1048463661 8:134643767-134643789 AGCTCATCCCCTCAGAATGGGGG No data
1048463653_1048463658 22 Left 1048463653 8:134643719-134643741 CCCTGAGCACGTTTTATGTTTGT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1048463658 8:134643764-134643786 ACTAGCTCATCCCCTCAGAATGG No data
1048463653_1048463659 23 Left 1048463653 8:134643719-134643741 CCCTGAGCACGTTTTATGTTTGT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463653_1048463660 24 Left 1048463653 8:134643719-134643741 CCCTGAGCACGTTTTATGTTTGT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1048463660 8:134643766-134643788 TAGCTCATCCCCTCAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048463653 Original CRISPR ACAAACATAAAACGTGCTCA GGG (reversed) Intronic
901452352 1:9343772-9343794 AAAAACAAAAAACCTGCTAATGG - Intronic
904596048 1:31646127-31646149 ACAAACAAAAAACCTGCCTAAGG - Intergenic
905085019 1:35365949-35365971 ACATAAATAATACGTACTCAAGG + Intronic
906410826 1:45577591-45577613 AGAAACAAAAAACATGCTCCAGG + Intergenic
910264012 1:85319574-85319596 ACAAAGAAAAAATGTTCTCAAGG - Exonic
911011108 1:93281716-93281738 ACAAGCATAAAAAGTGCTTCAGG + Intergenic
911188042 1:94923198-94923220 AAAAACATAACAGGTACTCAAGG - Intronic
917309072 1:173658588-173658610 GCAAATATAATACGTGGTCATGG - Intronic
919903305 1:202059840-202059862 AAAAACATAAAAAGAGCTCTTGG - Intergenic
920764619 1:208819994-208820016 AGAAACATAAAACGTGGGAAGGG - Intergenic
920840084 1:209546725-209546747 ACAAACATGCAACGTGAGCAGGG + Intergenic
923870441 1:237987515-237987537 ACAAAAATAAAAAATGCTTAAGG - Intergenic
924221686 1:241883129-241883151 AGAAACATAATATATGCTCATGG - Intronic
924495314 1:244583180-244583202 ACAAACATAAAAAGTGTCCTTGG - Intronic
924534910 1:244927287-244927309 ACAAACACAAAACGTGCCTACGG - Intergenic
924903678 1:248429501-248429523 ACAAACAAAAACTGTGCTGATGG - Intergenic
1063207899 10:3852275-3852297 ATAAACATAATACATGCTCCAGG - Intergenic
1063247362 10:4235787-4235809 AGAAACACAAAATGTGTTCAGGG + Intergenic
1063602593 10:7495983-7496005 AAAAACAAAAAACATGCTTACGG - Intergenic
1064691635 10:17924400-17924422 ACAAACTGAAAAAATGCTCAAGG + Intergenic
1065235133 10:23642268-23642290 AAAAAAAAAAAATGTGCTCAAGG - Intergenic
1066375465 10:34854271-34854293 ACAAACAAAAGAAGAGCTCAGGG - Intergenic
1067531851 10:47080127-47080149 ACAAACAGAAAACGTCATAAAGG - Intergenic
1067680172 10:48430071-48430093 ACAAACAAAAAACCTTCTTAAGG - Intronic
1068691601 10:59921304-59921326 ACACACATAAAACAAGCTTATGG + Intergenic
1068731701 10:60365382-60365404 ACAAACATGAAAACTGCTCAAGG - Intronic
1070250224 10:74766853-74766875 ACAAAAACAAAAGGTGCCCAGGG + Intergenic
1071940705 10:90588404-90588426 AAACATACAAAACGTGCTCAAGG - Intergenic
1072658905 10:97350262-97350284 ATACACATAAAATCTGCTCAGGG + Intergenic
1073504269 10:103970055-103970077 ACAAATAAGAAACTTGCTCAAGG - Intronic
1074597049 10:114877106-114877128 ACAAACGTACAACGAACTCAAGG + Intronic
1075224074 10:120609737-120609759 ATTAACATAAAACTTGCTGATGG - Intergenic
1075728070 10:124620750-124620772 ACAAACATGAAACCAGCTAAAGG + Exonic
1076062110 10:127420888-127420910 ACAAACAAATAAACTGCTCACGG - Intronic
1076080703 10:127578205-127578227 ACGAACATAAAATGAACTCAGGG + Intergenic
1079282688 11:19101868-19101890 ACAAACAAAAAACCTCCTCCAGG - Intergenic
1079689356 11:23403342-23403364 ACAAACAAAAAACACTCTCAAGG + Intergenic
1080496315 11:32823862-32823884 ACAAACAAAAAACATTTTCAGGG - Intergenic
1082255101 11:50025567-50025589 ACAAACAAAAAACATGCACTGGG - Intergenic
1084318479 11:68359761-68359783 ACAAACAAAAAAAGAGGTCAAGG - Intronic
1087479462 11:98680869-98680891 ACAAACAAAAAAGGTGCTGCTGG - Intergenic
1087855015 11:103081010-103081032 AAAAAAAAAAAACATGCTCATGG + Intronic
1090945984 11:131430201-131430223 ACAAAAATACAACATGCTTAAGG + Intronic
1091905416 12:4182921-4182943 AAAAACATAAAATGTGCTACAGG + Intergenic
1095613724 12:44163827-44163849 ACAAACATTGAACCTGCTAATGG + Intronic
1095676198 12:44921641-44921663 AAAAACAAAAAAAGTGCTAATGG + Intronic
1095895441 12:47275775-47275797 ACAAAAAGAAAACATGCTCCAGG - Intergenic
1096355105 12:50934346-50934368 AAAAACAGATAACTTGCTCAAGG - Intergenic
1096963770 12:55607832-55607854 ACAAAAACAAACGGTGCTCAGGG - Intergenic
1098481454 12:70966646-70966668 AGAAACATAAAAAGTGAGCATGG - Intergenic
1098775698 12:74612135-74612157 AAAAACATTAAAAGTTCTCAGGG - Intergenic
1099616557 12:84942964-84942986 ACAAACAAAAAACATGGTCAAGG - Intergenic
1101008567 12:100426784-100426806 ACAAACATAAAACCAGGTAAGGG + Intergenic
1101207455 12:102502926-102502948 ACACACATAAAAAGTGCTGCAGG - Intergenic
1101307161 12:103539982-103540004 AAAAACAAAAAACGACCTCATGG - Intergenic
1102576303 12:113858225-113858247 TCAAAAATAAAAGGTTCTCAAGG + Intronic
1103004602 12:117410662-117410684 ACAAACAGAATACTTTCTCAAGG - Intronic
1106243204 13:27926161-27926183 ACAAACATAACCCGAGCACAAGG - Exonic
1108931511 13:55829256-55829278 ACAAACAAAAAACCTGGCCAGGG + Intergenic
1110129762 13:71992577-71992599 ACAAACAGAAAACACCCTCAAGG + Intergenic
1110314121 13:74085438-74085460 TCATACATAACAAGTGCTCAAGG - Intronic
1111382139 13:87471431-87471453 ACAAAAATAAACAGAGCTCAGGG + Intergenic
1112177334 13:97039262-97039284 ACAAACAGAAAACCAGATCATGG - Intergenic
1113040692 13:106101025-106101047 ACAAAAATAAAATATTCTCAGGG - Intergenic
1113230730 13:108212274-108212296 ACAAACGTAAAATGTCCTGAGGG + Intronic
1115225229 14:31095410-31095432 ACAAACAAAAAACGGGATAAAGG - Intronic
1117438527 14:55740221-55740243 ACAGAAATAAAAATTGCTCAGGG - Intergenic
1118247762 14:64127923-64127945 AGAAACAAAAAAAGTGGTCAGGG + Intronic
1119135992 14:72220668-72220690 AGAAAAATAAAACAGGCTCAAGG + Intronic
1119437012 14:74604252-74604274 ACACACATAAAACAGTCTCAAGG + Intronic
1124812809 15:32958705-32958727 ACAAACGTGAAATGTGCTGAGGG + Intronic
1125239343 15:37555714-37555736 ACAAACATAAAACCTTATCTTGG + Intergenic
1129565871 15:76623008-76623030 AGAGACATAAAAAATGCTCACGG - Intronic
1133560969 16:6949925-6949947 ACAACAAAAAAACGTACTCAGGG - Intronic
1134760727 16:16712382-16712404 CCAAAAATAAAAAGTGCTAATGG - Intergenic
1134985332 16:18646792-18646814 CCAAAAATAAAAAGTGCTAATGG + Intergenic
1135020310 16:18957460-18957482 ACAAACAAAAAACATGGGCATGG + Intergenic
1135641529 16:24123799-24123821 GCACACAGAAAACATGCTCAGGG - Intronic
1135963390 16:27016133-27016155 AGAAACACAAAGAGTGCTCAAGG + Intergenic
1136094748 16:27947109-27947131 ACAAAAACAAAACTTGCTCCAGG - Intronic
1137303226 16:47174067-47174089 ACAAACAAAAAAAGTTTTCAAGG + Intronic
1137818316 16:51420552-51420574 CCAAACATAACCCCTGCTCATGG - Intergenic
1138775526 16:59718646-59718668 ACAACAACAAAACGTGTTCAGGG + Intronic
1140519679 16:75570339-75570361 ATAAACATAAAAAGTGCTACAGG + Intronic
1143510350 17:7392204-7392226 ACAAACAAAAAAAGAACTCAAGG + Intronic
1149230409 17:54527298-54527320 ACAGACATAAAACTTGGACAAGG - Intergenic
1149564735 17:57633115-57633137 AAAAAAATAAAACGTCATCAGGG - Intronic
1150032857 17:61758581-61758603 ACAAACATAGAAAGGCCTCAAGG + Intronic
1150984969 17:70185586-70185608 CCAAAAATAAAAAGTGCACAAGG + Intergenic
1153050365 18:897599-897621 ACAAACATATCACATACTCATGG - Intergenic
1153561617 18:6376743-6376765 ACAAACAAAAAACATAGTCAGGG + Intronic
1159477903 18:68947674-68947696 ATAAAAATAAAATATGCTCAGGG - Intronic
1160013961 18:75126789-75126811 ACAAACACAAAACACACTCAAGG - Intergenic
1162216784 19:9141007-9141029 AAAAATATAAAAGGTACTCAAGG - Intronic
1163690009 19:18733377-18733399 AGAGAAACAAAACGTGCTCACGG + Intronic
1164605834 19:29597481-29597503 TTAGACATAAAAGGTGCTCAAGG - Intergenic
1165125964 19:33597596-33597618 AAAAAATTAAAACCTGCTCAAGG - Intergenic
926965003 2:18400153-18400175 ACAAATATGGAACCTGCTCATGG + Intergenic
927168244 2:20346735-20346757 ACACACATACAATGTGGTCATGG - Intronic
928951214 2:36814721-36814743 ACAAAAATGAAACTTGCTGAGGG - Exonic
929586446 2:43118168-43118190 ACAAACATTAAACGTGATTCTGG - Intergenic
929718355 2:44337318-44337340 AAAAACATAAAATGTGCTGTGGG - Intronic
930217844 2:48715192-48715214 AAAAACATAAAATGTAATCATGG - Intronic
930459979 2:51661615-51661637 AAAAACAAAAAACATGTTCAAGG + Intergenic
930687028 2:54320479-54320501 AGAAAGATACAACTTGCTCAAGG + Intergenic
932389647 2:71374970-71374992 AAAAAAATAAAACTTGCTAAAGG - Intronic
936101277 2:109582217-109582239 ACAAACTGAAAAAATGCTCATGG + Intronic
936884444 2:117293391-117293413 AGAAACATAACACCTGATCATGG + Intergenic
938237279 2:129716688-129716710 AAAATCATAAGAGGTGCTCATGG + Intergenic
939165881 2:138640841-138640863 TCCAACATAAAACAAGCTCAGGG + Intergenic
941216158 2:162711880-162711902 ACAAACAAAAAAAATGCTAAGGG + Intronic
941324631 2:164098369-164098391 ACCAACATGAAACTTTCTCAAGG + Intergenic
942051481 2:172144992-172145014 ACAAACATGAAATATGCTCTAGG - Intergenic
943021616 2:182581325-182581347 ACAAACCTCAAACGGCCTCATGG + Intergenic
944656256 2:201879369-201879391 ACAAACAAAAAACATGTTCAAGG - Intronic
944953985 2:204786407-204786429 GCAAACAGAAGACATGCTCAAGG - Intronic
945599608 2:211843628-211843650 ATAAACATAAAACTAGCTTAAGG - Intronic
945821349 2:214669570-214669592 AGAAACATAAAACTTTCCCAAGG - Intergenic
946744972 2:222836521-222836543 AAAAAAATAAAACGTGGGCATGG + Intergenic
949019168 2:241731418-241731440 ACAAACATAACAGGAGCTGATGG + Intergenic
1170616269 20:17954704-17954726 AAAAACAAAAAAAGTGCTCAAGG - Intronic
1171305128 20:24098663-24098685 ACCAACATAAAACTAGGTCAGGG - Intergenic
1172417282 20:34780173-34780195 ACAAACATCAAATTTGCTTATGG + Intronic
1172957248 20:38769714-38769736 ACAAACATAAAATGTGCTCTGGG + Intronic
1177245887 21:18522698-18522720 ACAGAGATAAAAAGGGCTCAGGG + Intergenic
1177351313 21:19945519-19945541 ACAAACAGGAAAAATGCTCATGG - Intergenic
1177904009 21:26952933-26952955 AGAAACATGAGACTTGCTCAAGG - Intronic
1178617897 21:34149728-34149750 ACACACATAAAACAAGCTCACGG + Intergenic
1178943085 21:36923714-36923736 ACAAAAATAAAACATTCTAAAGG + Intronic
1180590240 22:16930997-16931019 AATAACACAAAAAGTGCTCAGGG + Intergenic
1181691619 22:24565635-24565657 ACAAACAAAAAACGTGTTTTGGG - Intronic
1184710063 22:46244542-46244564 ATAAACATAATACATGGTCAAGG + Exonic
951910964 3:27750057-27750079 ACAAAAATAAAACATGGTCCAGG - Intergenic
952591823 3:34964401-34964423 ACAGGCATAAAACCTCCTCAGGG - Intergenic
952863926 3:37838787-37838809 ACAAAGATAAAACTGGATCATGG + Intergenic
955953584 3:64266330-64266352 ACAGAAATAAAAGTTGCTCAAGG + Intronic
957699289 3:83687989-83688011 ACAACCAAAAAAAGTGCTCTGGG - Intergenic
957924502 3:86791171-86791193 GAAAACATAAAAGGTGCTCAAGG - Intergenic
959752346 3:109853450-109853472 AAAAAAATGAAATGTGCTCATGG - Intergenic
960324176 3:116274976-116274998 ACAAAAATAAAAGTTGCTCTGGG - Intronic
960835231 3:121899321-121899343 ACATACATAAAAACTGATCAAGG - Intronic
962166796 3:133058056-133058078 AAAAAAATCCAACGTGCTCAAGG - Intronic
965408298 3:168298337-168298359 AGAAAGATATAATGTGCTCATGG - Intergenic
967240090 3:187430232-187430254 ACAAACAAAAAAACTACTCAGGG - Intergenic
970363547 4:15334839-15334861 AAAAACATGAAAAATGCTCAAGG + Intergenic
971341377 4:25772517-25772539 AGATACATAAAAAATGCTCATGG + Intronic
972432589 4:38997625-38997647 ACAATCATAAAATATGCTGATGG - Intronic
976326360 4:83776197-83776219 TCAAACATAAAACTTCCTCCAGG - Intergenic
976847616 4:89508261-89508283 AGAAGCATAAAATATGCTCATGG + Intergenic
979475556 4:121153273-121153295 ACAAACATGAAGAGTGCACATGG + Intronic
981126271 4:141110413-141110435 ACAAACAAAAAACTCTCTCAAGG - Intronic
981331680 4:143516431-143516453 ACAAAAATAAAATGTGCTTCAGG - Intronic
983323139 4:166219914-166219936 ATAAACATTAGATGTGCTCAAGG + Intergenic
983614702 4:169689990-169690012 AAAAAGATTAAATGTGCTCAGGG + Intronic
986550118 5:8944066-8944088 ACAAACCCAAACCGTGCTCACGG - Intergenic
986997082 5:13619761-13619783 ATAAACATAAAAGGTGTGCAGGG - Intergenic
990346799 5:54879749-54879771 ACAAACATCAAACATGCCCTGGG + Intergenic
990947232 5:61262089-61262111 ACATACATAACAGGAGCTCATGG + Intergenic
991584777 5:68190773-68190795 ATAAACATAAAACTCACTCAAGG - Intronic
992359768 5:76025163-76025185 AAAAAAAAAAAACGTGCTCAAGG - Intergenic
992891281 5:81206663-81206685 CCAAACAGAAAACATGCTCAAGG - Intronic
993083447 5:83332372-83332394 ACAAACATAAAAAGAGATAAAGG - Intronic
993419585 5:87684178-87684200 ACAAACATAAAAACTTCACAGGG - Intergenic
995375620 5:111471322-111471344 AAAAAAATAAATCTTGCTCATGG - Intronic
1000596397 5:163219468-163219490 ACAAACAAAGCATGTGCTCAGGG + Intergenic
1000634731 5:163631094-163631116 ACAAAAATAATATGTGCCCATGG + Intergenic
1001325982 5:170724833-170724855 ACAGAGATAAATCATGCTCATGG + Intronic
1002833578 6:846384-846406 ATAAACATGAACAGTGCTCAAGG - Intergenic
1003386039 6:5668655-5668677 ACAAAAAAGAAACTTGCTCAAGG - Intronic
1004495464 6:16158893-16158915 ACAAAGATAATACCTGTTCATGG + Intergenic
1005030111 6:21500667-21500689 AAAAACAAAAAACAGGCTCAAGG - Intergenic
1006028197 6:31160769-31160791 ACAAACAAAAAGCTTGCCCAGGG + Intronic
1007255099 6:40522838-40522860 ACAAACATGACACAGGCTCAGGG - Intronic
1008441462 6:51536415-51536437 ACGCACATAGAAAGTGCTCAAGG - Intergenic
1010366048 6:75052303-75052325 ACAAACAAAAAACAAGCTCAAGG - Intergenic
1015708496 6:136113966-136113988 ATACAAAGAAAACGTGCTCAGGG + Intronic
1017593190 6:155999145-155999167 ACAAACAAAAAAGGTGATCCAGG - Intergenic
1017928692 6:158933537-158933559 ACACACACAAAAAGTCCTCAAGG + Intergenic
1018238756 6:161752391-161752413 ACAAACAAAAAACTCGCTCAAGG + Intronic
1019083236 6:169450557-169450579 ACATACATGGCACGTGCTCAGGG + Intergenic
1020498197 7:8883341-8883363 ACACACAAAAAACATGCACATGG + Intergenic
1023267012 7:38417276-38417298 ACAAAAACAAAACATCCTCAAGG + Intronic
1024748537 7:52434915-52434937 TAAAACATAAAACATCCTCAGGG + Intergenic
1029950991 7:104585331-104585353 ACAAAAATAATACTTGCTTATGG - Intronic
1031946217 7:127843701-127843723 ACATACACAAAACCTGCCCATGG - Intronic
1039874108 8:41570968-41570990 AAAAAAATAAAAAGTGGTCAAGG + Intergenic
1042331388 8:67584175-67584197 ACAAACAAAAAAAGTGCTCAGGG + Intronic
1042682636 8:71403339-71403361 ACACACATAAAAAGTGTTCAAGG + Intergenic
1043762668 8:84088129-84088151 CCAAAAATAAAAAGTGCTAATGG - Intergenic
1045146813 8:99354951-99354973 ACAAACAAAAAACCTAGTCATGG + Intronic
1045397443 8:101775028-101775050 ACAAATAGGAAACTTGCTCAGGG + Intronic
1046353695 8:113049404-113049426 AAAAAAAAAAAAAGTGCTCAGGG + Intronic
1048463653 8:134643719-134643741 ACAAACATAAAACGTGCTCAGGG - Intronic
1048693239 8:136991114-136991136 ACAAACATATACTGTGTTCATGG - Intergenic
1052149178 9:25091808-25091830 ACAAACAAAAAATGTGCAAAAGG - Intergenic
1053919121 9:42971666-42971688 ACAAACAAAAAACCTACTGAGGG + Intergenic
1057140661 9:92725022-92725044 ACAAACCTAGAAGGTGCTCCAGG + Intronic
1058149462 9:101448387-101448409 ACAAACTTAAGAAGTGCACAGGG - Intergenic
1059164971 9:112068871-112068893 ACAAACGGAAACCTTGCTCAGGG + Intronic
1060909473 9:127337904-127337926 ACAAACATTGAACCTACTCATGG + Intronic
1061173737 9:128978696-128978718 ACAAACAAAAAAACTGCTTAAGG - Intronic
1188690135 X:33119260-33119282 ACACATATAAAATGAGCTCAAGG + Intronic
1189406977 X:40734105-40734127 ACATACATGAAACTTTCTCATGG + Intronic
1192875332 X:75223439-75223461 ATAAACATAAAAAGTAGTCAAGG - Intergenic
1196326249 X:114407062-114407084 TCAAACAGAATATGTGCTCAAGG + Intergenic
1201973781 Y:19824625-19824647 ACAAAAAAAAATCATGCTCATGG + Intergenic