ID: 1048463654

View in Genome Browser
Species Human (GRCh38)
Location 8:134643720-134643742
Sequence AACAAACATAAAACGTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048463654_1048463658 21 Left 1048463654 8:134643720-134643742 CCTGAGCACGTTTTATGTTTGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1048463658 8:134643764-134643786 ACTAGCTCATCCCCTCAGAATGG No data
1048463654_1048463659 22 Left 1048463654 8:134643720-134643742 CCTGAGCACGTTTTATGTTTGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463654_1048463661 24 Left 1048463654 8:134643720-134643742 CCTGAGCACGTTTTATGTTTGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1048463661 8:134643767-134643789 AGCTCATCCCCTCAGAATGGGGG No data
1048463654_1048463660 23 Left 1048463654 8:134643720-134643742 CCTGAGCACGTTTTATGTTTGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1048463660 8:134643766-134643788 TAGCTCATCCCCTCAGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048463654 Original CRISPR AACAAACATAAAACGTGCTC AGG (reversed) Intronic
901008444 1:6183426-6183448 AACACCCATAAAACGTTCTCAGG - Intronic
901538209 1:9897157-9897179 AACAAACAAAAAACGTGGCCAGG + Intronic
903430570 1:23295318-23295340 AACAAACAAAAAATGAGTTCTGG + Intergenic
904558486 1:31381079-31381101 AACAAACAAAAAACCAGCCCAGG + Intergenic
905705248 1:40051539-40051561 AACAAACAAAAAACAGGGTCTGG - Intronic
905959067 1:42028126-42028148 AAGAAAAATAAAACTTGGTCAGG - Intronic
907094053 1:51759330-51759352 AACAAACATACACTGTGTTCAGG - Intronic
907864545 1:58387088-58387110 AACAAACAAAAAAAGTGTTTTGG + Intronic
907943857 1:59114433-59114455 GAGATACATAAAATGTGCTCTGG + Intergenic
908526776 1:64995499-64995521 AACAAACAAAAAACGTGCACAGG - Intergenic
908787363 1:67748498-67748520 AAAAAACAGAAATCGTGCTTGGG + Intronic
910175795 1:84428981-84429003 AACAAACAAAAAACCTGCCTGGG + Intergenic
911114424 1:94231566-94231588 GACAAAGAAAAAACGTGCTTGGG - Exonic
911410626 1:97501750-97501772 AACACTGATAAAAAGTGCTCTGG + Intronic
914409753 1:147414976-147414998 ACTTAACATAAAACGTTCTCAGG + Intergenic
915678233 1:157552026-157552048 AACAAACATGAAACATTCTCTGG + Intronic
915964639 1:160295696-160295718 AACAAACAACAAAAGTGCTATGG + Intronic
916178504 1:162063323-162063345 TAAAAACATAAAGCTTGCTCTGG - Intergenic
916783164 1:168058553-168058575 AACAAACAAAAAACCAGATCAGG - Intronic
917490966 1:175498128-175498150 AACAAACACAAATCCTGCTTGGG + Intronic
919659304 1:200228317-200228339 AAAAAAAAAAAAACGTGGTCAGG + Intergenic
920764620 1:208819995-208820017 AAGAAACATAAAACGTGGGAAGG - Intergenic
922089174 1:222379265-222379287 AACAAACATAGCAGGAGCTCTGG - Intergenic
923443282 1:234041613-234041635 AACAATTATAAAACATGCTGTGG - Intronic
1062908071 10:1192565-1192587 AAGAAACATAAAAAGTACTATGG + Intronic
1063247361 10:4235786-4235808 AAGAAACACAAAATGTGTTCAGG + Intergenic
1064171164 10:13034720-13034742 AACAAACAAAAAACCAGGTCTGG + Intronic
1065746487 10:28847255-28847277 AACAAACAAAAAACCTGAACTGG - Exonic
1066006862 10:31153832-31153854 ACCAAACATAAACCCAGCTCTGG - Intergenic
1066262417 10:33742279-33742301 AATATACATAAAACGTTTTCAGG - Intergenic
1066375466 10:34854272-34854294 AACAAACAAAAGAAGAGCTCAGG - Intergenic
1068207968 10:53882276-53882298 AACAAACAAAAAAGGTGATGTGG - Intronic
1069051495 10:63799533-63799555 AACAAACAAAAAAGGAGCTGCGG - Intergenic
1069956621 10:72055889-72055911 AAAAAACAAAAAACATGCACAGG - Intergenic
1070250223 10:74766852-74766874 AACAAAAACAAAAGGTGCCCAGG + Intergenic
1071576846 10:86733542-86733564 AACAAACTTAAAACCTTCTTGGG + Exonic
1072043825 10:91634917-91634939 AACAAAAAAAAAACCTGCCCAGG + Intergenic
1073504542 10:103973605-103973627 AACAGAGATAAAACATGCACAGG - Intronic
1073677865 10:105669634-105669656 TACAACCATAAAACATGCACTGG + Intergenic
1073920052 10:108448450-108448472 AAATAAAATAAAACATGCTCTGG - Intergenic
1075403993 10:122182267-122182289 ACCAAACATGAAACCTGCTCTGG + Intronic
1075971384 10:126656915-126656937 AACAAACATACAACTAGTTCGGG + Intronic
1076485784 10:130816104-130816126 AAAAAGAATAAAACGTGCTTAGG + Intergenic
1076999948 11:317919-317941 AAAAAACCTGAAACGTGGTCAGG + Intergenic
1077621901 11:3732720-3732742 AACAAATATAGAACATCCTCAGG - Intronic
1079236486 11:18694393-18694415 AAAAAAAAAAAAAAGTGCTCTGG + Intronic
1080491644 11:32771106-32771128 AACAAACACAAAACTTTCTGTGG - Intronic
1080496316 11:32823863-32823885 AACAAACAAAAAACATTTTCAGG - Intergenic
1081009225 11:37787054-37787076 AACAAACAAAAAACCTGCATTGG + Intergenic
1082100192 11:48166613-48166635 AACATACATAAAACAGGATCTGG - Intronic
1082189782 11:49228894-49228916 GACACACATAAAATGTGCTGAGG - Intergenic
1082255102 11:50025568-50025590 AACAAACAAAAAACATGCACTGG - Intergenic
1084451584 11:69242034-69242056 AACAAACAAAAAACATGTGCTGG + Intergenic
1085921949 11:80967949-80967971 AACAAACAAAAAACCCACTCTGG + Intergenic
1087133785 11:94694105-94694127 AACAATCATCAAACCTCCTCTGG + Intergenic
1089970113 11:122686528-122686550 AACAACCATAAAACTTGTTTGGG + Intronic
1090087086 11:123659773-123659795 ACTAAACATAAATAGTGCTCTGG - Intergenic
1091142926 11:133251541-133251563 AACAAACAAAAAACTAGATCTGG - Intronic
1092573409 12:9750694-9750716 AACAAACTTAAAACATTATCTGG - Intergenic
1095445296 12:42276424-42276446 AACAAACAAAAAACGTGCTCTGG + Intronic
1096963771 12:55607833-55607855 AACAAAAACAAACGGTGCTCAGG - Intergenic
1097123882 12:56757631-56757653 AAAAAAAAAAAAAAGTGCTCTGG + Intronic
1098153679 12:67574751-67574773 AACAAATATAAAAGGAGCTGTGG - Intergenic
1098775699 12:74612136-74612158 AAAAAACATTAAAAGTTCTCAGG - Intergenic
1099065858 12:77977870-77977892 AACTATCATAAAATGAGCTCTGG - Intronic
1099287039 12:80726123-80726145 AACAAGCATAAAAACAGCTCAGG + Intergenic
1099857984 12:88192748-88192770 AAAAAACTTTAATCGTGCTCTGG + Exonic
1100657056 12:96658608-96658630 AACAAAAAAAAAAAGTACTCTGG - Intronic
1101008566 12:100426783-100426805 AACAAACATAAAACCAGGTAAGG + Intergenic
1101251785 12:102944148-102944170 AAGAAACAAAAAACGTGCAACGG - Intronic
1106685442 13:32054426-32054448 AAAAAAAATAAAACTTGCTTGGG + Intronic
1107336077 13:39357008-39357030 AAAAAATATAAAACGTTATCTGG + Intronic
1108270255 13:48752182-48752204 AAAAAAAATAAAATGTGCTGTGG - Intergenic
1108879712 13:55095542-55095564 AACAAACAAAAAAATTGTTCAGG + Intergenic
1108931510 13:55829255-55829277 AACAAACAAAAAACCTGGCCAGG + Intergenic
1111382138 13:87471430-87471452 AACAAAAATAAACAGAGCTCAGG + Intergenic
1112691722 13:101903835-101903857 AACAAACACAAAAGGCCCTCTGG - Intronic
1112708867 13:102103732-102103754 ACCTAAAATAAAACCTGCTCAGG - Intronic
1113134907 13:107078590-107078612 AACAAACATAAAACTCTGTCTGG - Intergenic
1113230729 13:108212273-108212295 AACAAACGTAAAATGTCCTGAGG + Intronic
1113845213 13:113384512-113384534 AACAAACAAAAAACCTACGCAGG - Intergenic
1116343172 14:43752986-43753008 AACAAACATAAACTGTTTTCTGG - Intergenic
1116715861 14:48425784-48425806 AACAAACATAGTACCTGTTCAGG + Intergenic
1117365447 14:55022698-55022720 AACAAACAAAAAACCTGTTCAGG + Intronic
1117887227 14:60377660-60377682 AAGAAACATAAAACTTGGCCGGG - Intergenic
1118247761 14:64127922-64127944 AAGAAACAAAAAAAGTGGTCAGG + Intronic
1118702025 14:68442737-68442759 AACATACATAAAAGCTGCACCGG - Intronic
1121832428 14:97063679-97063701 AACAAACAAAAAATCTGCTGTGG + Intergenic
1123664573 15:22598374-22598396 AACAAACAAAAAAAGTGACCCGG - Intergenic
1124565032 15:30804624-30804646 AACAAACAAAAAAAGTGACCCGG + Intergenic
1127240359 15:57106719-57106741 AACAAATAGAAAACTTGCACTGG + Intronic
1132134149 15:99316821-99316843 AACAAACAAAAAACCTTCCCTGG - Intronic
1133560970 16:6949926-6949948 AACAACAAAAAAACGTACTCAGG - Intronic
1134768990 16:16788277-16788299 AAAAAACAAAAAACGTGATCAGG + Intergenic
1135461999 16:22652544-22652566 TACAAAAATAAAAAGTGCTTGGG + Intergenic
1135641530 16:24123800-24123822 AGCACACAGAAAACATGCTCAGG - Intronic
1135900117 16:26450206-26450228 AACAAACAAAAAACCAGCTTTGG + Intergenic
1137360167 16:47807108-47807130 AACAAACAAAAAACTTGTTTGGG - Intergenic
1137919431 16:52472310-52472332 AACAAACAAACAACATGCTGTGG + Intronic
1143200157 17:5107449-5107471 ATAAAACATAAAATGTGCTATGG - Intronic
1148664803 17:49366412-49366434 AACAAACAAAAAACAGGTTCTGG - Intergenic
1149015527 17:51904514-51904536 AGCAAATATAAAAGGAGCTCTGG - Intronic
1149564736 17:57633116-57633138 AAAAAAAATAAAACGTCATCAGG - Intronic
1151735748 17:75939305-75939327 AAAAAAAAAAAAACGTGCTCTGG + Intronic
1152669171 17:81591460-81591482 AAAAAAAAAAAAACCTGCTCTGG + Intronic
1153561616 18:6376742-6376764 AACAAACAAAAAACATAGTCAGG + Intronic
1153748964 18:8210007-8210029 AAAAAAAAAAAAAGGTGCTCGGG + Intronic
1153834280 18:8950184-8950206 AACAAACATAAAAACTGCTAGGG - Intergenic
1154105902 18:11522718-11522740 AAAAAACAGAAAACTTTCTCAGG - Intergenic
1155307532 18:24493156-24493178 AACAAAAATAAAATGTGTTTGGG - Intergenic
1155640106 18:28003339-28003361 AAAAAAGATAAAACCTGGTCTGG + Intronic
1158252588 18:55506160-55506182 AACAATGATAAAAAGTGTTCTGG - Intronic
1159011183 18:63060070-63060092 AACAAACATCGATCGTGCTTCGG + Intergenic
1159477904 18:68947675-68947697 AATAAAAATAAAATATGCTCAGG - Intronic
1159534557 18:69699479-69699501 AACAAACAAAAAACCTGAGCTGG + Intronic
1161146752 19:2683518-2683540 AACAAACAAAAACGATGCTCAGG + Intronic
1164824102 19:31271645-31271667 AAAACACAGAAAAGGTGCTCAGG - Intergenic
1166987663 19:46671319-46671341 AACAAATAAAAAACATGCCCGGG + Intergenic
1167876531 19:52418509-52418531 CACAACCAGAAAACTTGCTCTGG - Intergenic
925642205 2:5996544-5996566 AACAAACAAAAAAGGTGGCCAGG + Intergenic
926094260 2:10070947-10070969 AACAAACAAAAAGGGTTCTCAGG - Intronic
926950104 2:18233198-18233220 AACAAACAGAAAAACTTCTCTGG + Intronic
927025948 2:19069409-19069431 AGGAAACAAAAAACATGCTCTGG - Intergenic
929718356 2:44337319-44337341 CAAAAACATAAAATGTGCTGTGG - Intronic
931154428 2:59611726-59611748 AACAAACAAAAAACAAACTCTGG - Intergenic
932111656 2:69007345-69007367 AACAAATAGAAAACATGCTTTGG - Intergenic
934819374 2:97358875-97358897 AAATAACACAAAATGTGCTCTGG - Intergenic
935874396 2:107490287-107490309 AACAAACAAAAAACTTGCCAAGG + Intergenic
940262916 2:151801960-151801982 AGCAAACATAAAAGGTGTTTTGG + Exonic
941121528 2:161536198-161536220 AACAACCAGAAAATGAGCTCCGG + Intronic
941216157 2:162711879-162711901 AACAAACAAAAAAAATGCTAAGG + Intronic
941347292 2:164386249-164386271 AAAAAACATAAAACTCTCTCGGG + Intergenic
945403809 2:209422153-209422175 AACAAAAACAAAAAGTGCTGAGG + Intergenic
945831331 2:214789906-214789928 AACAAACATAAAATGGCCTTTGG + Intronic
947207550 2:227675622-227675644 AACAAACATAAAACATAAGCAGG + Intergenic
948840740 2:240647642-240647664 AACAAACAGGACACGCGCTCTGG + Intergenic
1171451782 20:25240679-25240701 AAAAAAAAAAAAAAGTGCTCTGG + Intergenic
1172957247 20:38769713-38769735 CACAAACATAAAATGTGCTCTGG + Intronic
1173829306 20:46070157-46070179 AACATACATAAAAAGAACTCAGG + Intronic
1174306395 20:49616951-49616973 AAAAAACATACAACGTGGCCGGG + Intergenic
1174951301 20:55043968-55043990 AATAAACTTAAAATGTTCTCAGG - Intergenic
1178105158 21:29310252-29310274 AACAAACAAAAAATGTGCCTTGG - Intronic
1180590239 22:16930996-16931018 AAATAACACAAAAAGTGCTCAGG + Intergenic
1180615595 22:17123834-17123856 AACAAACAAAAAACCTGGCCGGG + Intronic
1181691620 22:24565636-24565658 AACAAACAAAAAACGTGTTTTGG - Intronic
1182383786 22:29917490-29917512 AACAAACAAAAAAATTGCACTGG + Intronic
1183636331 22:39065288-39065310 AACAAACAAAAAACATTTTCTGG + Intronic
1184426811 22:44413862-44413884 AACAAAAATAAAACCTACTTTGG - Intergenic
1184532839 22:45067406-45067428 AACAAACAAAAACAGTGCACAGG + Intergenic
1185058800 22:48594868-48594890 AAAAAAAAAAAAATGTGCTCAGG - Intronic
950099727 3:10349472-10349494 AATAAAAATAAAAAGTGCCCAGG + Intronic
951366621 3:21791336-21791358 AACAAACATAAAATATGCAGTGG + Intronic
951700671 3:25493334-25493356 AACAAACAAAAAACACCCTCTGG - Intronic
952157473 3:30658992-30659014 AACAAACATAAAATGAGATTTGG - Intronic
953321076 3:41972079-41972101 ATCAAAAATAAAACGTGGCCGGG - Intergenic
956445176 3:69319026-69319048 AACAAACACAAACCCTGCTGTGG + Intronic
957699290 3:83687990-83688012 CACAACCAAAAAAAGTGCTCTGG - Intergenic
958254790 3:91313240-91313262 AACACACTTCAAATGTGCTCTGG + Intergenic
958410660 3:93811276-93811298 AACAAACAAAAAACATGCATTGG + Intergenic
958709322 3:97697986-97698008 AACAAACAAAAAACATGCATTGG - Intronic
960324177 3:116274977-116274999 CACAAAAATAAAAGTTGCTCTGG - Intronic
960764982 3:121116472-121116494 AATAAACAAAAATCCTGCTCTGG - Intronic
966578386 3:181529918-181529940 AACAAACTTAAAAGGTGGTTGGG + Intergenic
967240091 3:187430233-187430255 AACAAACAAAAAAACTACTCAGG - Intergenic
967836634 3:193970314-193970336 TACAAACCTAAAACGTCCTCAGG - Intergenic
969268188 4:6079819-6079841 AACAAACAAAAAGCCTTCTCTGG + Intronic
970890415 4:21037942-21037964 AACAAACATACAAAATGCTGGGG + Intronic
970918021 4:21358338-21358360 AACAAAAATAAAAAGTGATTCGG + Intronic
971649004 4:29247449-29247471 AACAATATTAAAACCTGCTCTGG + Intergenic
973056911 4:45671512-45671534 TAATAACATAAAATGTGCTCTGG - Intergenic
975056215 4:69933551-69933573 AACAATGATAAAACTTCCTCAGG + Intronic
976291407 4:83422063-83422085 AACAAACAAAAAACGTGGCCGGG + Intronic
977783086 4:101001903-101001925 AACAAACATCAAATGAGTTCTGG - Intergenic
978780974 4:112553652-112553674 AGCAAACATAAAACATACACTGG + Intronic
979717817 4:123862673-123862695 AACAAAAATAAAAACTGCTCTGG - Intergenic
979745927 4:124212983-124213005 AACAAACAAAAAAAATGTTCTGG + Intergenic
980960864 4:139473539-139473561 AAAAAACAAAAAAAGTACTCTGG - Exonic
981753987 4:148121170-148121192 AAGAAACAGAAAACGAGGTCTGG + Intronic
983152739 4:164304829-164304851 AACAAACGTAAAACCTCCTGTGG - Intronic
984793637 4:183637116-183637138 AACAAACAGAAAACGGGCAGGGG + Intergenic
985228276 4:187785962-187785984 AACAAAAGCAAAACATGCTCTGG + Intergenic
986997083 5:13619762-13619784 AATAAACATAAAAGGTGTGCAGG - Intergenic
987497182 5:18662150-18662172 AACAAACATCAAATGTGCCCTGG + Intergenic
990346798 5:54879748-54879770 CACAAACATCAAACATGCCCTGG + Intergenic
990594451 5:57299158-57299180 AACAAACACATCACGTGTTCAGG - Intergenic
990800586 5:59598415-59598437 AACATCAATAAAACGTGCTGAGG - Intronic
991172984 5:63650190-63650212 AACACACAGAAAAGGTGCTGAGG - Intergenic
991657196 5:68915862-68915884 AAAAAACAAAAAACCTGCCCTGG - Intergenic
992758520 5:79931641-79931663 AACAACCATCAAACCTGCTGTGG + Intergenic
993419586 5:87684179-87684201 AACAAACATAAAAACTTCACAGG - Intergenic
994748836 5:103713115-103713137 AAAAAAAAAAAAAGGTGCTCTGG - Intergenic
995829495 5:116338531-116338553 AACAAACAAAAAACCAGCCCAGG + Intronic
996190549 5:120535805-120535827 AACAAACAAAAAACTTGGCCAGG + Intronic
1001351251 5:170967253-170967275 TACATACATAAAACATTCTCTGG + Intronic
1002658593 5:180773749-180773771 AACAAACAGAAAGCATGCTCAGG - Intergenic
1002672055 5:180875516-180875538 AACAAAGACAAAACGTCCACAGG + Intergenic
1002823582 6:752717-752739 AACAAACAAAAAGCATGTTCTGG - Intergenic
1006028196 6:31160768-31160790 AACAAACAAAAAGCTTGCCCAGG + Intronic
1007705316 6:43787315-43787337 AAAATACATAAAATGTGCTGGGG + Intergenic
1009000568 6:57707837-57707859 AACACACTTCAAATGTGCTCTGG - Intergenic
1009189033 6:60607264-60607286 AACACACTTCAAATGTGCTCTGG - Intergenic
1009606327 6:65873465-65873487 AACCAACATAAGACCTGTTCTGG + Intergenic
1010054411 6:71547960-71547982 GACACAAATAATACGTGCTCTGG - Intergenic
1010830288 6:80519211-80519233 AACAAACAGGTAAAGTGCTCAGG + Intergenic
1012216397 6:96591099-96591121 TACAAACAGAGAACATGCTCTGG - Intronic
1012299113 6:97562912-97562934 AAGAAACAAAAAACGTGATACGG - Intergenic
1014497516 6:122144255-122144277 AAGAAACACAAAGCATGCTCTGG + Intergenic
1015304896 6:131696760-131696782 AAAAAAAAAAAAAGGTGCTCTGG - Intronic
1015660325 6:135567168-135567190 AACAAATGCAAAAGGTGCTCTGG + Intergenic
1015731076 6:136348904-136348926 AACAAACATGAAATGTCTTCTGG + Intronic
1017919447 6:158858403-158858425 AACAAACAAAAAAAGAACTCTGG + Intergenic
1021794578 7:24241118-24241140 AACAAACAAAAAAATTGCTTGGG + Intergenic
1023930901 7:44705847-44705869 AACAAACATGTATCGTACTCGGG - Intronic
1024545687 7:50515523-50515545 AACAAACAAAAAAAGTACACAGG + Intronic
1024748536 7:52434914-52434936 ATAAAACATAAAACATCCTCAGG + Intergenic
1024802647 7:53098902-53098924 AACGAACATAAAGCTTGCTATGG - Intergenic
1026898286 7:74023090-74023112 AACAAACAAGAGGCGTGCTCTGG + Intergenic
1026964344 7:74429755-74429777 AACAAAAATAAAAAGAGCCCAGG - Intergenic
1027120850 7:75518665-75518687 AAAAAAAAAAAAAAGTGCTCGGG + Intergenic
1027377390 7:77565573-77565595 AACAAACTTTAAACATTCTCAGG + Intronic
1027377696 7:77569773-77569795 AACAAACAAACAAAGTGCTGTGG + Intronic
1028212175 7:88087429-88087451 AACAAAAATAAAACAAGCTTTGG - Intronic
1029369560 7:100139969-100139991 AACAAACAAAAAACATGCTGAGG - Intergenic
1029401447 7:100349414-100349436 AACAAACATAAAACATTAACAGG + Intronic
1029721936 7:102373348-102373370 AAAAAAAAAAAAAAGTGCTCGGG - Intronic
1031492452 7:122405665-122405687 AACAAACAAAAAACCGGCTTAGG + Intronic
1032890223 7:136186627-136186649 AACAAACAAAAAAAGTGTTGAGG - Intergenic
1033307142 7:140232961-140232983 AAAAAACATAACACGCGCCCTGG - Intergenic
1034334898 7:150315469-150315491 AAAATACAGAAAACATGCTCAGG + Intronic
1035841413 8:2815246-2815268 AACAAAAAAAAAACTTGCACAGG - Intergenic
1035927554 8:3744687-3744709 AATAAACATGAAACGTTGTCTGG + Intronic
1037377437 8:18246574-18246596 AACAAACAAAAAACCAGCTCAGG + Intergenic
1038409795 8:27349230-27349252 AACAAACAGAAAAAGGGATCTGG - Intronic
1040319394 8:46285065-46285087 ATCAAACCTAACACCTGCTCAGG + Intergenic
1042331387 8:67584174-67584196 AACAAACAAAAAAAGTGCTCAGG + Intronic
1044286896 8:90420213-90420235 AACAAACACAAGATGAGCTCTGG - Intergenic
1044869021 8:96600439-96600461 AACAAACAAAAATCATGCTCAGG + Intronic
1045219473 8:100183582-100183604 AAAAAACATCAAAAGTGCTGAGG - Intronic
1046353694 8:113049403-113049425 AAAAAAAAAAAAAAGTGCTCAGG + Intronic
1047185235 8:122627213-122627235 AACAAACACAAAAACTGATCTGG - Intergenic
1048463654 8:134643720-134643742 AACAAACATAAAACGTGCTCAGG - Intronic
1049822171 8:144642186-144642208 AACAAAGATAAAAAGTGGGCTGG + Intergenic
1050338947 9:4616571-4616593 AACAAACAAAAAACTGGCTCTGG - Intronic
1051901080 9:22041324-22041346 AACAAAAATAAAATGTACTGTGG + Intergenic
1052273482 9:26652138-26652160 AAAAGACCTAAAAAGTGCTCAGG - Intergenic
1052409444 9:28104246-28104268 AACAAACAAAAAACTTGTACTGG - Intronic
1053919120 9:42971665-42971687 AACAAACAAAAAACCTACTGAGG + Intergenic
1057352419 9:94310230-94310252 ATAAAACATAAAACGTGGTAAGG - Intergenic
1057455326 9:95203579-95203601 AACCAAAATAAAAAGTGCTTTGG - Intronic
1058149463 9:101448388-101448410 AACAAACTTAAGAAGTGCACAGG - Intergenic
1059011109 9:110461168-110461190 CTCAAACATAAAACAAGCTCGGG + Intronic
1059164970 9:112068870-112068892 AACAAACGGAAACCTTGCTCAGG + Intronic
1059208807 9:112491644-112491666 AACAAACAAAAAACATTTTCAGG - Intronic
1059289858 9:113213102-113213124 AGCAAAAATAAAAAGTGCACAGG + Intronic
1062118025 9:134819484-134819506 TACAAACATAAAAGGTACTCAGG + Intronic
1185565818 X:1094408-1094430 GGCAAAAATAAAACCTGCTCAGG - Intergenic
1185763113 X:2703435-2703457 AACCCACATAAAACGCGCTTAGG + Intronic
1186899729 X:14041116-14041138 GACAAGAATAAAATGTGCTCAGG - Intergenic
1190513507 X:51198059-51198081 AGCAAACATGAAATGTTCTCAGG - Intergenic
1193088139 X:77465815-77465837 AAAAAACAAAAAACCTGTTCAGG + Intergenic
1193777326 X:85658709-85658731 AACAAACATAGGATGTGTTCAGG - Intergenic
1195962581 X:110401481-110401503 AATAAATATAATATGTGCTCTGG - Intronic
1196806943 X:119596825-119596847 AACAAACAGAAAACGTAGCCAGG + Intronic
1196882571 X:120212091-120212113 AACAAAAAAAAAACGAGCACAGG - Intergenic
1200283096 X:154795123-154795145 AACAAACAAAAAACATGGTGAGG + Intronic