ID: 1048463655

View in Genome Browser
Species Human (GRCh38)
Location 8:134643745-134643767
Sequence TAGTAACAGGAGCTGTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048463655_1048463660 -2 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463660 8:134643766-134643788 TAGCTCATCCCCTCAGAATGGGG No data
1048463655_1048463658 -4 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463658 8:134643764-134643786 ACTAGCTCATCCCCTCAGAATGG No data
1048463655_1048463659 -3 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463655_1048463661 -1 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463661 8:134643767-134643789 AGCTCATCCCCTCAGAATGGGGG No data
1048463655_1048463665 23 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463665 8:134643791-134643813 GCCTTTTGTAATCTGCACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048463655 Original CRISPR TAGTAACAGGAGCTGTTTCT GGG (reversed) Intronic
902256475 1:15192369-15192391 TAGTATCAGGAACTCCTTCTTGG + Intronic
905489945 1:38335465-38335487 TCGTAACAGGAGCAGGTTATGGG - Intergenic
909699350 1:78504262-78504284 TACTAACAGTAGTTATTTCTGGG - Intronic
911478492 1:98404681-98404703 TATAAAAAGGAGCTGTTTCAGGG - Intergenic
912102472 1:106227996-106228018 TAGGCACTGGAGCTTTTTCTGGG - Intergenic
912186034 1:107276907-107276929 CTGTTACAGTAGCTGTTTCTTGG - Intronic
912623475 1:111188914-111188936 AAACAACAGAAGCTGTTTCTTGG + Intronic
913343260 1:117781272-117781294 CACTCACTGGAGCTGTTTCTGGG + Intergenic
915249687 1:154579239-154579261 TAGTAACAGGAGCTAATACTGGG - Exonic
916955707 1:169832315-169832337 TATTAATAGCAGCTCTTTCTAGG - Intronic
917586750 1:176434757-176434779 TAGTATCAGGACCTGATTATAGG - Intergenic
918236678 1:182587154-182587176 TATTAACATTGGCTGTTTCTGGG - Intronic
920577282 1:207070743-207070765 TAGGAGCAGCAGTTGTTTCTGGG + Intronic
923336342 1:232973965-232973987 TAGTAACAGGAGATGAGTGTGGG + Intronic
924813246 1:247421586-247421608 TAATACCAGAAGCTGTTTCATGG - Intronic
1064678109 10:17781953-17781975 TTGTAACCGCACCTGTTTCTAGG + Intronic
1064822694 10:19356127-19356149 TAGTTACAGGACATCTTTCTTGG + Intronic
1066477143 10:35758330-35758352 TAAGAACCGGAGCTGGTTCTCGG + Intergenic
1067982198 10:51099129-51099151 TTGTCTCAGGATCTGTTTCTGGG + Intronic
1069214151 10:65798374-65798396 TACTAGCAGGAGCTGTAACTTGG - Intergenic
1071102829 10:82059503-82059525 TAGAAGGAGGAGCTGTTTCTAGG + Intronic
1071396249 10:85226920-85226942 TAGTAAAAGGAGGTGGTTTTTGG + Intergenic
1073537033 10:104286931-104286953 TAATAACAGTGGTTGTTTCTGGG - Intronic
1073920859 10:108457160-108457182 TAGTAACATGAGCTTTTTCCTGG - Intergenic
1075176296 10:120164593-120164615 TATTATCAGAAGCTATTTCTGGG - Intergenic
1075343159 10:121663177-121663199 TAAACGCAGGAGCTGTTTCTGGG - Intergenic
1077904463 11:6519142-6519164 TTATAATAGAAGCTGTTTCTGGG - Intronic
1078882136 11:15462634-15462656 TAGTGCCAGGAGGTGTTTCTAGG - Intergenic
1083255515 11:61493114-61493136 TAGCAACAGCATCTGCTTCTGGG - Intergenic
1089021484 11:115219926-115219948 TAGTAAGTGCTGCTGTTTCTGGG - Intronic
1090138792 11:124230294-124230316 TAGAAACAGAAGCTCTTTGTTGG + Intergenic
1091674885 12:2482013-2482035 GAGTTGGAGGAGCTGTTTCTGGG + Intronic
1094548462 12:31427724-31427746 TAGTAAAAGTAGCAGTTTATTGG + Intronic
1094743813 12:33319916-33319938 CTGTCACAGGGGCTGTTTCTAGG - Intergenic
1095767644 12:45914631-45914653 TATTAATAGAAGTTGTTTCTGGG - Intergenic
1096988459 12:55778453-55778475 TGGTAAAAGGAGCTGTTTAAAGG - Intronic
1097628153 12:62026451-62026473 TAGTGACAAGAGATGTTTCCAGG - Intronic
1098228762 12:68351604-68351626 TAGTTCCAAGAGATGTTTCTAGG + Intergenic
1098873335 12:75841007-75841029 TAGGAACAGAAGCCGTGTCTTGG - Intergenic
1100969103 12:100047587-100047609 CAGTTACAGGAGCTGGTTCAAGG + Exonic
1102592912 12:113970642-113970664 TGGTAACAGCAGTTGCTTCTGGG + Intergenic
1102965908 12:117125219-117125241 TAGGAACAGGTGCTCTTCCTTGG + Intergenic
1103956527 12:124580186-124580208 TAGTAGCAGGACCTGGTTCATGG + Intergenic
1107262038 13:38504349-38504371 TCATAACAGGAGCTATTTTTGGG + Intergenic
1108688515 13:52842069-52842091 AAGAAACAGGAGCTGTGTGTGGG - Intergenic
1108753859 13:53476450-53476472 GAGGAACAGGAACTGATTCTAGG + Intergenic
1110819527 13:79898416-79898438 TAGTAGCAGCAGCAGTATCTTGG - Intergenic
1112057686 13:95705861-95705883 TAGTAAAAGGAGTGTTTTCTAGG + Intronic
1113067282 13:106385163-106385185 AAGGAGCAGGTGCTGTTTCTTGG - Intergenic
1120329068 14:83065324-83065346 TATTAACAAAAGTTGTTTCTGGG + Intergenic
1121727072 14:96160472-96160494 TAGTAACAGGAACTGTCTCTAGG + Intergenic
1122420673 14:101574784-101574806 TAGTGCCAGCATCTGTTTCTGGG - Intergenic
1123503497 15:20913911-20913933 TAGAAAAAGGATCTTTTTCTGGG + Intergenic
1123596983 15:21924872-21924894 TAGAAAAAGGATCTTTTTCTGGG + Intergenic
1124436416 15:29652723-29652745 AAGTAGCAGGAGCAGTTTCCAGG - Intergenic
1126030363 15:44491400-44491422 TAGGAACAGAAGCAGTTTTTGGG - Intronic
1126061242 15:44784768-44784790 AAGTAACGGGTGCTTTTTCTAGG + Intergenic
1126230405 15:46316713-46316735 TAGTAACAGGAGTTATTTCTGGG + Intergenic
1126984458 15:54288199-54288221 TAGCAACAGAAGTAGTTTCTGGG + Intronic
1131015555 15:89054721-89054743 TATTAACAGTGGTTGTTTCTGGG - Intergenic
1131539895 15:93267124-93267146 AACTCACAGGAGCTGTTTTTGGG + Intergenic
1133617401 16:7490828-7490850 TAACAGCAGGTGCTGTTTCTGGG - Intronic
1138316790 16:56077131-56077153 TCTTAACAGGAACTGTGTCTGGG - Intergenic
1138759417 16:59522975-59522997 TAGCAACAGGAGGCGTTGCTAGG + Intergenic
1140247373 16:73263574-73263596 CAGAAACAGAAGCTGCTTCTGGG - Intergenic
1141835619 16:86537214-86537236 TATTAACAGTAGTTGTCTCTGGG - Intronic
1143253839 17:5541452-5541474 TAGTAACAGGTCCTCTTACTTGG - Intronic
1143253840 17:5541454-5541476 AAGTAAGAGGACCTGTTACTAGG + Intronic
1148076645 17:44940646-44940668 GAGGAACAGGGGCTGTTCCTGGG + Intronic
1149772807 17:59334129-59334151 GTGTACCAGGAGATGTTTCTAGG + Intronic
1150463132 17:65369783-65369805 TGGTAACAGTAATTGTTTCTGGG + Intergenic
1150797591 17:68250888-68250910 CAGAAACAGGAACTGGTTCTAGG - Exonic
1151505798 17:74526188-74526210 AGGCAACAGGAGCTGTATCTTGG - Intronic
1152285901 17:79413248-79413270 TTGTAACCAGAGCAGTTTCTTGG - Intronic
1152413733 17:80145730-80145752 CAGAATCAGGAGCTGTCTCTTGG - Intronic
1153435536 18:5064376-5064398 TAGTAGCATCAGCTGGTTCTGGG - Intergenic
1153812326 18:8762914-8762936 TTGTTACAGTGGCTGTTTCTGGG + Intronic
1155252308 18:23964306-23964328 TAGTAATAGGATCATTTTCTAGG - Intergenic
1155360485 18:24995065-24995087 AAGTAACAGATGCTGCTTCTGGG + Intergenic
1155830532 18:30510831-30510853 TAGGAATAAGAGCTGTTTGTGGG - Intergenic
1156872880 18:41967863-41967885 TATCAACAGCAGCTGTTGCTGGG + Intronic
1157676840 18:49575041-49575063 TTTTAACAGGAGCAGTTCCTTGG + Intronic
1158426620 18:57346287-57346309 CAGCAACAGCAGCTGCTTCTTGG + Intergenic
1159118859 18:64146312-64146334 TCATAATGGGAGCTGTTTCTTGG - Intergenic
1159266723 18:66089983-66090005 TTGGAGCAGGAGCTATTTCTGGG - Intergenic
1159639524 18:70847491-70847513 TAGCAAAAGGAACTGTTTCTGGG - Intergenic
1159917238 18:74198355-74198377 TTGGAACAGGAGCTGTTGATGGG + Intergenic
1160273472 18:77409107-77409129 CAGTGACAGGAGCTCATTCTAGG + Intergenic
1161509375 19:4662128-4662150 TACAAACAGCAGGTGTTTCTGGG - Intronic
1162392918 19:10400302-10400324 CACTAACAGCAGCTGTCTCTGGG + Intronic
1167805440 19:51780531-51780553 CAGGAACAGAAGCTGTTCCTGGG + Intronic
925907614 2:8548534-8548556 CAGGGACAGGAGCTGTGTCTGGG + Intergenic
926158347 2:10470561-10470583 TAGTAAAAGGAGCTGTGGCAAGG - Intergenic
927363776 2:22269716-22269738 TAGTAACAGATGCTCTCTCTGGG - Intergenic
927647399 2:24886713-24886735 TAGAAACTGGAGCTGGTTCCGGG + Intronic
927707060 2:25302923-25302945 TAGTTACAGGAGCAGCCTCTCGG + Intronic
927985906 2:27410146-27410168 TGGGAGGAGGAGCTGTTTCTTGG + Intergenic
928782743 2:34844896-34844918 TGGAAACAGCAGCTCTTTCTGGG - Intergenic
930657489 2:54020564-54020586 TATTTACAGGAGCAGTTTGTGGG - Intronic
933628483 2:84629753-84629775 AAGTAACCAGAGCTGGTTCTAGG + Intronic
933854024 2:86396065-86396087 TCGTACCAGGAGCTGTAGCTTGG + Intergenic
935334147 2:101999523-101999545 TAGAAACTGAAGCTGTATCTAGG + Intronic
935702162 2:105822140-105822162 TAGTTGCAGGAGATTTTTCTAGG - Intronic
937136930 2:119561394-119561416 TAGTAACAGGAAATGTGTCCTGG - Intronic
940572061 2:155448795-155448817 TAGATACAGGATCAGTTTCTTGG - Intergenic
940649650 2:156428887-156428909 GGGTAACAGGTGCTGTTCCTTGG - Intergenic
943223304 2:185137858-185137880 TACTCACAGGTGATGTTTCTAGG + Intergenic
943657455 2:190524791-190524813 AAGTACCAGGAACTATTTCTAGG - Intronic
944157354 2:196621351-196621373 TGGTAACAGAAGCTGATTTTGGG + Intergenic
944268945 2:197759918-197759940 CAGTCCCCGGAGCTGTTTCTTGG - Intronic
944662455 2:201932552-201932574 TAGTAACAGGACCTACTTCAAGG + Intergenic
946722288 2:222622389-222622411 TTTTAACAGCAGTTGTTTCTGGG + Intronic
947290162 2:228564732-228564754 TAGTAACGGTAACGGTTTCTTGG - Intergenic
948686161 2:239671017-239671039 TAGTAACTGGAACTCTTTCATGG + Intergenic
1169006498 20:2211670-2211692 TCCTGCCAGGAGCTGTTTCTGGG + Intergenic
1170287393 20:14725195-14725217 TGATAACAAGAGTTGTTTCTTGG + Intronic
1172058115 20:32168279-32168301 TAATAACAGAAGCTGTCTCAGGG - Intergenic
1172929426 20:38574036-38574058 TAGTAAAGGGACCTGTTGCTTGG - Intronic
1173169812 20:40714958-40714980 TACTGACATGGGCTGTTTCTAGG - Intergenic
1173707106 20:45118778-45118800 TTGTAACAGGGGCTGTTTATGGG + Intergenic
1173837000 20:46132449-46132471 TAGTCTCAGGATCTGCTTCTGGG + Intergenic
1175440141 20:58984615-58984637 TAGGAAGAAGATCTGTTTCTAGG + Intronic
1176047571 20:63100785-63100807 CAAGAGCAGGAGCTGTTTCTAGG + Intergenic
1177905981 21:26971703-26971725 TTGTAGTAGGAGTTGTTTCTCGG + Intergenic
1178838017 21:36114650-36114672 TGGTAACAGCAGTTGCTTCTGGG - Intergenic
1180992810 22:19947827-19947849 AAGTAACGGGTGCTTTTTCTAGG + Intronic
949473596 3:4421273-4421295 TAGTAACAGCACCTATATCTTGG + Intronic
949822964 3:8135616-8135638 TAGCAACATGAGCTGTCCCTAGG - Intergenic
949860266 3:8498992-8499014 GAGTGTCAGGAGCTGTTGCTTGG - Intergenic
950574695 3:13825129-13825151 TGGTAAGAGCAGCTGTCTCTGGG + Intronic
950951842 3:17008649-17008671 TAGAAACAGGGCCTGTTTCATGG + Intronic
951744088 3:25957532-25957554 TTGTCACAGGATGTGTTTCTGGG + Intergenic
952234770 3:31467690-31467712 TAGTAACAGAGGTAGTTTCTGGG + Intergenic
952426060 3:33175188-33175210 TGATCACAGGGGCTGTTTCTTGG + Intronic
953479152 3:43234491-43234513 CAGTAACAGAAGCTGTATATTGG - Intergenic
956742027 3:72282597-72282619 TTGTATGAGGATCTGTTTCTTGG - Intergenic
958712760 3:97738201-97738223 TAGTTAGAGGAAATGTTTCTTGG + Intronic
959907810 3:111729992-111730014 CAGTTCCAGGAGGTGTTTCTAGG + Intronic
963591555 3:147267154-147267176 TATTAACAGTAGTGGTTTCTGGG - Intergenic
964431708 3:156613933-156613955 AAAAAATAGGAGCTGTTTCTAGG + Intergenic
966042325 3:175507223-175507245 TACTAACAGTGCCTGTTTCTAGG + Intronic
967980866 3:195064554-195064576 TAGTAAGTGCAGCTGTGTCTTGG - Intergenic
967999506 3:195195122-195195144 TAGTAACAGCTGCTGTTTTATGG - Intronic
969370818 4:6730350-6730372 TTATAACAGCAGTTGTTTCTGGG + Intergenic
974473500 4:62349942-62349964 TAGAAAGTGGAGATGTTTCTTGG + Intergenic
974791278 4:66693166-66693188 TTGTAATAGGAGATGTTGCTAGG - Intergenic
976486918 4:85617367-85617389 TAGTAACAGGTGTTTTTGCTGGG - Intronic
977823703 4:101505217-101505239 AAGCAACAAGAGCTGTATCTGGG - Intronic
978301960 4:107279962-107279984 ATGTAACAGGAGCTGTGTCCTGG + Intronic
979998932 4:127465911-127465933 TACAAACAGAAGCTGTGTCTTGG - Intergenic
983114001 4:163789577-163789599 TAGAAAAAGGAGCTGATTCTTGG + Intronic
987308808 5:16663247-16663269 CAGTAAAAATAGCTGTTTCTGGG + Intronic
990240222 5:53809710-53809732 TAGTATCAAGAGCTGTGCCTGGG + Intergenic
993018402 5:82563057-82563079 TAGGGACTGGAGCTGTTCCTCGG + Intergenic
993125711 5:83833389-83833411 TAGTGCCAGCAGCTGCTTCTGGG - Intergenic
993378863 5:87182746-87182768 TAGTAAAAGGATTCGTTTCTAGG + Intergenic
995848426 5:116519447-116519469 TACTAACAAAAGCTGTTTCTGGG - Intronic
998739394 5:145181610-145181632 TATTAATAGTAGCTATTTCTGGG + Intergenic
998845159 5:146301686-146301708 ATGTAACAGGCGCTGTTTTTTGG - Intronic
1000046708 5:157527743-157527765 TAGTAACAACGGCTGTCTCTAGG + Intronic
1000354268 5:160378517-160378539 TGGTAACAGTAGCTGCTTCTGGG + Intergenic
1002688571 5:181034767-181034789 TTGTAAGAAAAGCTGTTTCTAGG + Intergenic
1004791660 6:19033458-19033480 TAGGGACAAGAGCTGTTACTAGG - Intergenic
1005664166 6:28033939-28033961 CAGTAAGATGAACTGTTTCTGGG - Intergenic
1007266942 6:40603700-40603722 TAGTACCAGGGTCTGCTTCTGGG + Intergenic
1008421216 6:51301292-51301314 TAGTAAGAGGTGCGGTTTTTTGG - Intergenic
1008635716 6:53408572-53408594 TAAGAACAAGAGCTGTATCTTGG - Intergenic
1011267224 6:85534866-85534888 TATTAATAGAAGCGGTTTCTGGG + Intronic
1011631849 6:89334414-89334436 TATTAACAGTAGCTATTTCTTGG + Intronic
1013179916 6:107708903-107708925 TAGGAAGAGGAGCTGGCTCTAGG - Intronic
1014348852 6:120313303-120313325 CAGTAACAGTATCTGTTTCTTGG + Intergenic
1016127054 6:140416777-140416799 TAGGAAGAGGAGCTGTTAATAGG - Intergenic
1017291134 6:152739041-152739063 TGTTAACAGGAGCTGTATTTTGG - Intergenic
1019593153 7:1845835-1845857 CAGAGCCAGGAGCTGTTTCTGGG + Intronic
1019861703 7:3664866-3664888 AAGTAACAGTTTCTGTTTCTTGG - Intronic
1019877920 7:3831693-3831715 TAGTAACAACAGCTGTTCATTGG + Intronic
1020569431 7:9839977-9839999 TACTGACAGGGGCAGTTTCTTGG - Intergenic
1024585426 7:50837701-50837723 AAGTAACAGGAGCTATTTACTGG + Intergenic
1030131267 7:106203326-106203348 TAGTTACAGATGCTGTCTCTGGG + Intergenic
1031246148 7:119314742-119314764 GTGTAACATTAGCTGTTTCTTGG + Intergenic
1032321519 7:130890310-130890332 TAGTAGGAGGAGCTGTCTTTTGG - Intergenic
1034693375 7:153032009-153032031 AAGTAACAGAAGCTGGTCCTGGG + Intergenic
1035661981 8:1355284-1355306 CAGTAACAGGGGTTGTCTCTGGG + Intergenic
1035931436 8:3784392-3784414 TACTAACAGCAGTTATTTCTGGG - Intronic
1038227559 8:25670857-25670879 TAGGAAAAGGAGGTGTTTGTTGG - Intergenic
1038435643 8:27534005-27534027 CATGAACAGCAGCTGTTTCTGGG + Intronic
1039372276 8:36997256-36997278 TAATGACAGAAGCTCTTTCTGGG - Intergenic
1041790571 8:61692431-61692453 TAGTACCAGTAGCTGTTACAAGG - Intronic
1042083670 8:65085484-65085506 TAGTGACAGAAGCTGCCTCTTGG - Intergenic
1042618517 8:70676658-70676680 CAGTAACAGTTTCTGTTTCTTGG + Intronic
1044770134 8:95622674-95622696 TAGGAAAAGGAGCTGTTTGGGGG + Intergenic
1044885371 8:96771358-96771380 AGGTTTCAGGAGCTGTTTCTAGG + Intronic
1045583651 8:103505181-103505203 TAGTAACAGTAGTTGGCTCTGGG - Intronic
1048249268 8:132846435-132846457 AAGGATCATGAGCTGTTTCTTGG + Exonic
1048463655 8:134643745-134643767 TAGTAACAGGAGCTGTTTCTGGG - Intronic
1048551312 8:135436122-135436144 TAGTAAGAGGTGCTCTTTCCTGG + Intergenic
1048697860 8:137048361-137048383 AATTAAAAGCAGCTGTTTCTGGG - Intergenic
1048969051 8:139634276-139634298 CAGTAACTGGAGCTGCTTGTTGG - Intronic
1049117249 8:140699658-140699680 TGGAAGCAGGAGTTGTTTCTGGG + Intronic
1049502051 8:142972130-142972152 TATGAACAGAAGCTGTGTCTTGG - Intergenic
1050751008 9:8936951-8936973 TAGTAAGAGGAGCACTTTTTTGG + Intronic
1051157098 9:14160538-14160560 TAGTTCCAGGAGCTGTTTTTTGG + Intronic
1052324043 9:27197852-27197874 TAGTAACAAGAAGTTTTTCTAGG + Intronic
1053266305 9:36716623-36716645 TAGTCACTGGCGCTGTGTCTCGG + Intergenic
1054760910 9:69003271-69003293 CAGAAACAGGAGCTGTGTGTAGG + Intronic
1056689099 9:88791042-88791064 TATTAACAAGAGCTGTATTTAGG - Intergenic
1056771554 9:89481307-89481329 AAGCAACAGGAGCTGGTTCAGGG + Intronic
1059158758 9:112013850-112013872 GAGTATTAGGATCTGTTTCTGGG - Intergenic
1059477048 9:114555675-114555697 TAGGAACAGGAGCTCCCTCTGGG + Intergenic
1060329729 9:122656056-122656078 TACTAATAGGATCTGTCTCTAGG + Intergenic
1187376087 X:18756040-18756062 TTTTAACAGTGGCTGTTTCTAGG + Intronic
1190364454 X:49678281-49678303 TTGGCACAGGACCTGTTTCTCGG + Intergenic
1190875042 X:54453753-54453775 TGGTAACAGTAGCTACTTCTAGG + Intronic
1192370462 X:70508557-70508579 TAGTGACAAGAGCTACTTCTTGG + Intergenic
1193808258 X:86019044-86019066 AGGTAACAGTAGCTGCTTCTGGG + Intronic
1194127445 X:90037513-90037535 GAGTACCAGGAGCTGTTTGATGG + Intergenic
1196680827 X:118467754-118467776 AAGTAACAGAAGCTGACTCTGGG + Intergenic
1197928496 X:131671704-131671726 TAGTAACAGGAACTTTATGTTGG + Intergenic
1198768861 X:140107023-140107045 TAGTAACACAAGCTGTTTGGGGG + Intergenic