ID: 1048463656

View in Genome Browser
Species Human (GRCh38)
Location 8:134643746-134643768
Sequence CTAGTAACAGGAGCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048463656_1048463665 22 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463665 8:134643791-134643813 GCCTTTTGTAATCTGCACAAAGG No data
1048463656_1048463660 -3 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463660 8:134643766-134643788 TAGCTCATCCCCTCAGAATGGGG No data
1048463656_1048463659 -4 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463656_1048463658 -5 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463658 8:134643764-134643786 ACTAGCTCATCCCCTCAGAATGG No data
1048463656_1048463661 -2 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463661 8:134643767-134643789 AGCTCATCCCCTCAGAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048463656 Original CRISPR CTAGTAACAGGAGCTGTTTC TGG (reversed) Intronic
902696305 1:18143085-18143107 CTAGTAACAGCAGATGTCTGCGG + Intronic
910552906 1:88497191-88497213 CTATTAAAAGAGGCTGTTTCAGG - Intergenic
911478493 1:98404682-98404704 GTATAAAAAGGAGCTGTTTCAGG - Intergenic
913051955 1:115125059-115125081 ATACTAACAGGAGTTCTTTCAGG + Intergenic
913343259 1:117781271-117781293 CCACTCACTGGAGCTGTTTCTGG + Intergenic
915249688 1:154579240-154579262 TTAGTAACAGGAGCTAATACTGG - Exonic
915673698 1:157511502-157511524 CTAGTGCCAGGACCTGTCTCTGG + Intergenic
918037231 1:180885848-180885870 CTAGTAACAGTAACTTTTACTGG - Exonic
922629931 1:227096446-227096468 GTAGTTACAGAATCTGTTTCAGG - Intronic
1063690751 10:8284822-8284844 CTATTAACAGGTGCTGATTCAGG - Intergenic
1067412558 10:46077737-46077759 TTAGTGTCAGGATCTGTTTCAGG + Intergenic
1067680772 10:48438485-48438507 CTAGTAACAGTAACACTTTCTGG + Exonic
1067766867 10:49093399-49093421 CTATTAAAAGGTGCTCTTTCAGG - Intronic
1067982197 10:51099128-51099150 CTTGTCTCAGGATCTGTTTCTGG + Intronic
1070725788 10:78788436-78788458 CTTTCAACAGGAGCCGTTTCTGG - Intergenic
1073085996 10:100889448-100889470 CTAGGACAAGGATCTGTTTCTGG + Intergenic
1077246773 11:1543535-1543557 CTTGTAACAGGTGCAGTTACCGG + Intergenic
1083175222 11:60945596-60945618 CTATTGACAGGAGCTGTAACTGG + Intronic
1086843865 11:91723421-91723443 CTAGTACCAGCATCTGCTTCTGG + Intergenic
1089021485 11:115219927-115219949 CTAGTAAGTGCTGCTGTTTCTGG - Intronic
1091136818 11:133198736-133198758 GGAGCAACAGGAGCTGTGTCAGG + Intronic
1093741631 12:22695097-22695119 CTAACAACATGAGGTGTTTCAGG + Intergenic
1094603366 12:31929971-31929993 CTTGTACCAGGATCTGTCTCGGG - Intergenic
1097836211 12:64275354-64275376 CTAGTTACAGAAGCTTATTCTGG - Exonic
1103560685 12:121792001-121792023 CTAGAGACAGGCGCTGTTTTGGG + Intronic
1104423164 12:128653725-128653747 CAAGTACCAGGTGCTGTTCCAGG - Intronic
1106185922 13:27409550-27409572 CTAGTAAAAGTATCTGTATCAGG - Intergenic
1106922963 13:34584070-34584092 CTATTTACAGAAGATGTTTCAGG + Intergenic
1108688516 13:52842070-52842092 CAAGAAACAGGAGCTGTGTGTGG - Intergenic
1110335946 13:74329946-74329968 CTAGTTAGAGGAGCAGTTTTTGG + Intergenic
1113546114 13:111152842-111152864 CTAGTAATTGGTACTGTTTCTGG + Intronic
1123503496 15:20913910-20913932 CTAGAAAAAGGATCTTTTTCTGG + Intergenic
1123596982 15:21924871-21924893 CTAGAAAAAGGATCTTTTTCTGG + Intergenic
1124715485 15:32056697-32056719 CTTTTAACAGGCTCTGTTTCAGG + Intronic
1126030364 15:44491401-44491423 CTAGGAACAGAAGCAGTTTTTGG - Intronic
1126230404 15:46316712-46316734 ATAGTAACAGGAGTTATTTCTGG + Intergenic
1126984457 15:54288198-54288220 CTAGCAACAGAAGTAGTTTCTGG + Intronic
1127948399 15:63779587-63779609 CCACTAACAGGATCTATTTCTGG + Intronic
1128712341 15:69881555-69881577 CTAGAAACATAGGCTGTTTCCGG - Intergenic
1129825337 15:78631141-78631163 CTCGTAGCGGGAGCTGTTCCAGG + Exonic
1130060959 15:80569660-80569682 CCAGTGAAAGGAGCTTTTTCTGG + Intronic
1130301413 15:82681856-82681878 CAAGGAACAGGAAGTGTTTCAGG - Intronic
1133099748 16:3471872-3471894 CTTGTGTCAGGAGCTGTCTCTGG + Intronic
1134684773 16:16150744-16150766 CCAGACACAGGAGCTGTTTCTGG + Exonic
1134877964 16:17719070-17719092 ATAGTAACAGGAGCTCTGCCAGG - Intergenic
1137767362 16:50988228-50988250 CTTATAACAGGAGCTCCTTCAGG + Intergenic
1138316791 16:56077132-56077154 CTCTTAACAGGAACTGTGTCTGG - Intergenic
1138603274 16:58070616-58070638 CCAGTGACAAGAGCTGTTTCTGG + Intergenic
1140290217 16:73646954-73646976 TGAGAAACAGGAGATGTTTCAGG + Intergenic
1141161372 16:81631058-81631080 CTAGTAACCAGGGCTGCTTCAGG + Intronic
1146380277 17:32322759-32322781 CTCCTAACAGGAGCTGGTGCAGG + Exonic
1146967699 17:37046899-37046921 CTTTTAACAGGAGCTGTTAGAGG + Intronic
1147258519 17:39195976-39195998 CTTGTAAGAAGAGCTGCTTCTGG + Intronic
1148175324 17:45559002-45559024 TTGGCATCAGGAGCTGTTTCAGG + Intergenic
1148296047 17:46503992-46504014 TTGGCATCAGGAGCTGTTTCAGG - Intergenic
1148975405 17:51523380-51523402 CTTGTACCATAAGCTGTTTCAGG + Intergenic
1150406541 17:64905946-64905968 TTGGCATCAGGAGCTGTTTCAGG + Intronic
1150463131 17:65369782-65369804 CTGGTAACAGTAATTGTTTCTGG + Intergenic
1152056543 17:78032594-78032616 CTAATAATTGGTGCTGTTTCTGG + Intronic
1152527821 17:80899478-80899500 CTATTCACAGGAGCTGTGGCCGG - Intronic
1153312698 18:3692750-3692772 TTAATAACAGAAGTTGTTTCAGG - Intronic
1154127252 18:11702613-11702635 CTACAAACTGGAGCTGTCTCAGG + Intronic
1155360484 18:24995064-24995086 CAAGTAACAGATGCTGCTTCTGG + Intergenic
1155830533 18:30510832-30510854 CTAGGAATAAGAGCTGTTTGTGG - Intergenic
1155837921 18:30610435-30610457 CAAGTAAGAGAAGCTGATTCTGG - Intergenic
1156222949 18:35072184-35072206 CTAATAACAGAAACTGTTTTTGG - Intronic
1157566579 18:48682754-48682776 CCAGTGACAGGAGCAGTTGCTGG - Intronic
1158024415 18:52878736-52878758 CTAGTGACTGGAGTAGTTTCTGG + Intronic
1159639525 18:70847492-70847514 TTAGCAAAAGGAACTGTTTCTGG - Intergenic
1162392917 19:10400301-10400323 CCACTAACAGCAGCTGTCTCTGG + Intronic
1163051574 19:14688763-14688785 CTAGTGACAGTGGTTGTTTCAGG + Intronic
1163405153 19:17117373-17117395 CTGGTTTCAGGAGCTGGTTCTGG - Intronic
927647398 2:24886712-24886734 TTAGAAACTGGAGCTGGTTCCGG + Intronic
928845134 2:35662651-35662673 ATAGTACCAGCAACTGTTTCTGG + Intergenic
929965768 2:46535370-46535392 CAAGCAACAGAAGCTGTTTGTGG + Intronic
936291267 2:111225668-111225690 CGAGTATCAGTAGCTGGTTCAGG + Intergenic
940782317 2:157945839-157945861 CCAGTAGCTGGAGCTCTTTCTGG - Intronic
941174420 2:162179342-162179364 CTAGTACCAGGAGATTTTTCAGG - Intronic
945238271 2:207653088-207653110 AGAGCAACAGGAGCTGTTGCTGG + Intergenic
946477890 2:220026195-220026217 CAAGAAACAGAAGCTGATTCTGG - Intergenic
947205716 2:227659311-227659333 GTAGTGACAGGACCTGTCTCCGG + Intergenic
948550588 2:238770069-238770091 CTGGTAATAGAAACTGTTTCCGG + Intergenic
948732736 2:239977374-239977396 CCAGAAACAGGAGCAGTGTCAGG - Intronic
1169677683 20:8172919-8172941 CTAGCAACAGAAGGTGGTTCAGG + Intronic
1170008690 20:11697176-11697198 CTTGTCTCAGGATCTGTTTCAGG - Intergenic
1172058116 20:32168280-32168302 CTAATAACAGAAGCTGTCTCAGG - Intergenic
1173707105 20:45118777-45118799 ATTGTAACAGGGGCTGTTTATGG + Intergenic
1173836999 20:46132448-46132470 CTAGTCTCAGGATCTGCTTCTGG + Intergenic
1174112679 20:48207027-48207049 GGAGGAACAGGAGCTGTCTCAGG - Intergenic
1178838018 21:36114651-36114673 CTGGTAACAGCAGTTGCTTCTGG - Intergenic
1181028355 22:20138281-20138303 CTTGTCACAGCAGCTGTCTCAGG + Intronic
1181940708 22:26473798-26473820 CAAGTAATAGGAACTTTTTCAGG - Intronic
1183312584 22:37118842-37118864 CTGGTATCAGGAGCTCTCTCGGG - Intergenic
949992941 3:9593990-9594012 CTAGTAAAAGTATCTGTATCAGG - Intergenic
951413320 3:22391903-22391925 CAAGATACAGGAGGTGTTTCAGG + Intergenic
951744087 3:25957531-25957553 CTTGTCACAGGATGTGTTTCTGG + Intergenic
952234769 3:31467689-31467711 CTAGTAACAGAGGTAGTTTCTGG + Intergenic
956410310 3:68972273-68972295 CTAGTGACAGAAGCTGCTTAGGG - Intergenic
957957486 3:87207158-87207180 CTGGTAAGAGGGTCTGTTTCAGG + Intergenic
962978121 3:140463855-140463877 CCAGTAGCAGGAGCTGATGCTGG + Intronic
964006702 3:151838344-151838366 TTTCTAACAGGAGCTGTTTTTGG - Intergenic
964287652 3:155137210-155137232 ACAGTAACAGGAGCTATTTATGG + Intronic
967152644 3:186663882-186663904 CTAGCAACTGGAGCAGCTTCAGG - Intronic
973907681 4:55547113-55547135 CTAGTAACCGGCGCCGTTCCCGG - Intronic
975222032 4:71823647-71823669 CTTGTAACAGAAACTGTTACAGG + Intergenic
975757752 4:77587886-77587908 CCAGGAGCAGGAGTTGTTTCTGG - Intronic
976734899 4:88299438-88299460 ATGGTAAAAGGAGCTGTTTTAGG - Intergenic
978413436 4:108450343-108450365 CAAGTAACAAAAGCTGTTACAGG + Intergenic
983847106 4:172533955-172533977 CTTGTCTCAGGATCTGTTTCTGG - Intronic
985593203 5:775913-775935 CTGGTGACAGGAGCTGTCCCAGG + Intergenic
986261097 5:6147118-6147140 CTAATAGCAGGTGCAGTTTCAGG + Intergenic
993361106 5:86977462-86977484 CTAGTATGAGAAACTGTTTCAGG - Intergenic
995791258 5:115890782-115890804 CCAGTAACTTGAGTTGTTTCCGG + Intronic
995848427 5:116519448-116519470 TTACTAACAAAAGCTGTTTCTGG - Intronic
999925365 5:156369969-156369991 CTAGTCACAAGAGCTATTACAGG + Intronic
1000354267 5:160378516-160378538 CTGGTAACAGTAGCTGCTTCTGG + Intergenic
1005664167 6:28033940-28033962 CCAGTAAGATGAACTGTTTCTGG - Intergenic
1006694262 6:35917989-35918011 CTAGTTACAGGAGGTGAGTCAGG - Intronic
1007266941 6:40603699-40603721 CTAGTACCAGGGTCTGCTTCTGG + Intergenic
1007470556 6:42087511-42087533 CCAGTGATAGTAGCTGTTTCTGG - Intergenic
1008193596 6:48491013-48491035 CTAGTAAAAGGAGCTTTATAGGG + Intergenic
1008781151 6:55107340-55107362 CTAGTAACGGGAGTTGCTTTGGG - Intronic
1011267223 6:85534865-85534887 CTATTAATAGAAGCGGTTTCTGG + Intronic
1015243205 6:131049304-131049326 CTTGTAACTAGAACTGTTTCTGG - Intronic
1015829244 6:137350022-137350044 CTAGCAACAGGTGCAGCTTCAGG - Intergenic
1015993016 6:138967816-138967838 CAAGTACCAGGCGCTGTTCCTGG + Intronic
1023909399 7:44542572-44542594 CTTGTTTCAGGATCTGTTTCTGG - Intergenic
1024175367 7:46835022-46835044 CTAGAAATATGAGATGTTTCAGG - Intergenic
1027584182 7:80036478-80036500 CCAGTAACAGGTTCTGTTTGAGG + Intergenic
1028456073 7:91039518-91039540 CTAGTAACAGCAGTGGTCTCTGG - Intronic
1028669233 7:93382136-93382158 CTAGTGCCAGGACCTGTGTCGGG + Intergenic
1030241723 7:107333667-107333689 ATAGTAACAGGTGTTGTCTCTGG + Intronic
1032022880 7:128419803-128419825 CAAGTAACTGGAGGTGTTTTAGG + Intergenic
1032673280 7:134105808-134105830 CTGGTAACACCAGCTGTTACTGG - Intergenic
1034096921 7:148417847-148417869 TTAGTAGCAGAAGCTGTTTTGGG - Exonic
1034693374 7:153032008-153032030 CAAGTAACAGAAGCTGGTCCTGG + Intergenic
1035872155 8:3147473-3147495 CAAGGAACTGGAGCTGCTTCGGG + Intronic
1039386681 8:37142466-37142488 CGGGTGACAGGAGTTGTTTCTGG - Intergenic
1041321784 8:56621351-56621373 CTAGTAATGGGAGCTGTTGGGGG + Intergenic
1041668087 8:60465516-60465538 GTAATAACAGGAGCAGATTCTGG + Intergenic
1044770133 8:95622673-95622695 TTAGGAAAAGGAGCTGTTTGGGG + Intergenic
1045583652 8:103505182-103505204 CTAGTAACAGTAGTTGGCTCTGG - Intronic
1048463656 8:134643746-134643768 CTAGTAACAGGAGCTGTTTCTGG - Intronic
1055075514 9:72211427-72211449 CTAGTAAGAAGAGCTGATTCTGG + Intronic
1056422925 9:86447210-86447232 GCAATAACAGGAGCTGTTTGGGG - Intergenic
1056647490 9:88426856-88426878 ATAGTAAAAGGAGTTTTTTCCGG + Intronic
1056771553 9:89481306-89481328 CAAGCAACAGGAGCTGGTTCAGG + Intronic
1057030591 9:91772325-91772347 CTAGAAACAGTAGCTGATGCTGG - Intronic
1057497975 9:95575212-95575234 CTTGTTAAAGGAGCTGTTTTGGG + Intergenic
1059477047 9:114555674-114555696 CTAGGAACAGGAGCTCCCTCTGG + Intergenic
1060854260 9:126902352-126902374 CTAGTGCCAGGACCTGTCTCAGG - Intergenic
1061469178 9:130809284-130809306 CTGGGAACAGGAACTATTTCTGG - Intronic
1061926867 9:133810226-133810248 CTGCTAACCGGCGCTGTTTCTGG - Intronic
1187622564 X:21074487-21074509 CTAGTAAAAGGACATGTTTGGGG - Intergenic
1188962811 X:36513535-36513557 CTAGTGACAGATTCTGTTTCAGG + Intergenic
1188964222 X:36531043-36531065 CAAGGAACAGAAGCTCTTTCAGG + Intergenic
1191220017 X:57977990-57978012 CTACGAAAAGGGGCTGTTTCCGG + Intergenic
1192237658 X:69306137-69306159 CCAGTACCAGGAGCTGGCTCAGG + Intergenic
1192968743 X:76207908-76207930 CTAGTGCCAGGACCTGTCTCAGG + Intergenic
1195852582 X:109298931-109298953 CTAGTAACTGGAACTGTATGTGG - Intergenic
1196295953 X:113997767-113997789 TTACCAACAGTAGCTGTTTCTGG - Intergenic
1196680826 X:118467753-118467775 CAAGTAACAGAAGCTGACTCTGG + Intergenic
1197973020 X:132134587-132134609 CCAGTACCAGGAGCTTTTTTAGG - Intergenic
1198453302 X:136790060-136790082 TGAGTATCAGGAGCTGTTTTTGG + Intergenic
1198768860 X:140107022-140107044 ATAGTAACACAAGCTGTTTGGGG + Intergenic