ID: 1048463659

View in Genome Browser
Species Human (GRCh38)
Location 8:134643765-134643787
Sequence CTAGCTCATCCCCTCAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048463656_1048463659 -4 Left 1048463656 8:134643746-134643768 CCAGAAACAGCTCCTGTTACTAG 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463654_1048463659 22 Left 1048463654 8:134643720-134643742 CCTGAGCACGTTTTATGTTTGTT 0: 1
1: 1
2: 3
3: 20
4: 240
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463655_1048463659 -3 Left 1048463655 8:134643745-134643767 CCCAGAAACAGCTCCTGTTACTA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data
1048463653_1048463659 23 Left 1048463653 8:134643719-134643741 CCCTGAGCACGTTTTATGTTTGT 0: 1
1: 0
2: 2
3: 13
4: 190
Right 1048463659 8:134643765-134643787 CTAGCTCATCCCCTCAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048463659 Original CRISPR CTAGCTCATCCCCTCAGAAT GGG Intronic
No off target data available for this crispr