ID: 1048464005

View in Genome Browser
Species Human (GRCh38)
Location 8:134648094-134648116
Sequence TGTGAAATGATACCACAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048464005 Original CRISPR TGTGAAATGATACCACAATC AGG (reversed) Intronic
901837205 1:11932072-11932094 TATGAAATAATCCCACAACCTGG + Intergenic
903429773 1:23286341-23286363 TGTGAAATGTTAACAATATCAGG + Intergenic
904096350 1:27981143-27981165 TCTGAAATGATAGCAAAATATGG - Intronic
904278539 1:29400749-29400771 TGTGAGATGATACCTCATTGTGG + Intergenic
906360222 1:45150281-45150303 TGTGAAATGGTATCTCAATGTGG - Intronic
907686110 1:56613449-56613471 TGTGAAATGGTACCTCATTGTGG - Intronic
907793164 1:57688355-57688377 TGTCAGATGATATCTCAATCCGG - Intronic
908504561 1:64783432-64783454 TGTGAAATGATATCTCACTGTGG + Intronic
908825591 1:68129986-68130008 TGTGAAATGAGACCAATCTCTGG + Intronic
908930063 1:69307124-69307146 CGTGAAATGATACCTCATTATGG + Intergenic
909375862 1:74941253-74941275 TGAGAATTGAAACCACAATAAGG - Intergenic
909809462 1:79913583-79913605 TGTGAAATCACTTCACAATCAGG - Intergenic
910959152 1:92742720-92742742 TGTGAAATGATATCTCATTGTGG - Intronic
912926637 1:113918868-113918890 TGTGAGATGGTACCACATTGTGG - Intergenic
913227937 1:116716526-116716548 TGTGAAGTGATAGCACATTGTGG - Intergenic
913374792 1:118139252-118139274 TGTGAGATGATACCACATTATGG - Intronic
916909454 1:169330344-169330366 TGTGAGATGGTACCACATTGTGG - Intronic
917234534 1:172876625-172876647 TGTGAAGTGATACCTCATTGTGG + Intergenic
918153826 1:181823749-181823771 TGTGAAAGGTTTCTACAATCTGG + Intergenic
918609633 1:186473662-186473684 TTTGAAATGATACTTCAAACTGG + Intergenic
922189605 1:223306304-223306326 CATGATATAATACCACAATCTGG - Intronic
923152834 1:231249397-231249419 TGTTAACTGAGACCACAATTTGG - Intronic
924726180 1:246673215-246673237 TGTGACAGTATACCACAAACCGG - Intergenic
1064849440 10:19694513-19694535 TGTGAGATGATATCTCATTCTGG - Intronic
1064880751 10:20050644-20050666 TGTGAAATGATATCTCATTGGGG - Intronic
1065662927 10:28024763-28024785 TGTGGTATAATATCACAATCAGG + Intergenic
1066812659 10:39360750-39360772 TGTGAGATGATATCACATTGTGG + Intergenic
1067714629 10:48680987-48681009 TGTGAAATAATTCCAACATCTGG + Intergenic
1068247230 10:54388911-54388933 TGAGGAATGATACCATAATAGGG + Intronic
1068346009 10:55778960-55778982 TGTGAAATGATATCATATTGTGG + Intergenic
1068470492 10:57456208-57456230 TGTGAAATGACATCACATTGTGG - Intergenic
1069269607 10:66509090-66509112 TGTGAGATGATACCTCATTGTGG + Intronic
1069333643 10:67322921-67322943 TGTGAGATGATACCTCATTGTGG + Intronic
1071759876 10:88590587-88590609 TGTGAAAAGATACCACGTTTGGG - Exonic
1073544500 10:104337355-104337377 TGTGAAATGAGACCAGTATCTGG + Intronic
1073669152 10:105568103-105568125 TGTGAAATGAAACTTCAAGCAGG - Intergenic
1073713034 10:106067375-106067397 AGTGAAATGATACCTCATTGTGG - Intergenic
1074007037 10:109437249-109437271 TGTTAATTGATAGCACCATCAGG - Intergenic
1074319685 10:112390321-112390343 TGTGAAATGGTACCTCATTGTGG - Intronic
1075164758 10:120057591-120057613 TGTGAAATGATATCTCATTGTGG - Intergenic
1075508973 10:123053548-123053570 TGTGAAATAGTACCATATTCAGG + Intronic
1075983434 10:126761757-126761779 TGTGAAATGATATCTCATTGTGG + Intergenic
1076294611 10:129374864-129374886 TGAAAAATGCTACCACCATCTGG + Intergenic
1077592554 11:3503935-3503957 TGGGAGATGATACCAGAATTGGG + Intergenic
1077951824 11:6967506-6967528 TGTGAGATGATACCTCATTGTGG + Intronic
1077966727 11:7141906-7141928 TAGGAAATGACACCACAACCTGG - Intergenic
1078345705 11:10545947-10545969 TGTAAAATAATACAACAATTTGG + Intergenic
1078593757 11:12669010-12669032 TCTTACATGATACCACCATCTGG - Intergenic
1078712437 11:13807395-13807417 TGCTAAATAAAACCACAATCAGG + Intergenic
1078887712 11:15521477-15521499 TGTGAAATGATATCTCATTATGG + Intergenic
1079107128 11:17578752-17578774 TGTGAAATGGAACCATCATCAGG + Intronic
1079971153 11:27037308-27037330 TGTGAAATGATATCTCATTGTGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1084824431 11:71718822-71718844 TGGGAGATGATACCAGAATTGGG - Intergenic
1087038803 11:93778856-93778878 TGTGATATGATACCTCAATGTGG + Intronic
1087481039 11:98700661-98700683 TGTGAAATGGTACCTCACTGTGG - Intergenic
1087578373 11:100019888-100019910 TGTGAGGTGATACCACATTGTGG + Intronic
1088003638 11:104913706-104913728 TGTGAAGTGATATCACATTGTGG - Intergenic
1088584448 11:111349441-111349463 TGTGAAATGATATCTCATTGCGG - Intergenic
1091004374 11:131939299-131939321 TGTGGAATGCTGCCACAACCAGG + Intronic
1091083620 11:132697398-132697420 TGTCAAATGATACAACATTTTGG - Intronic
1091448095 12:556116-556138 TGTGAAATGGTATCACACTGTGG + Intronic
1091983746 12:4889868-4889890 AGTGAAATTAAACCACAAGCTGG + Intergenic
1092418674 12:8312056-8312078 TGGGAGATGATACCAGAATTGGG + Intergenic
1093216858 12:16372468-16372490 AGTGAGATGATACCACATTGTGG - Intronic
1093228069 12:16509663-16509685 TGTGTAATGACAGCACACTCAGG - Intronic
1093355851 12:18165965-18165987 TGTTAAATGAAACTAAAATCTGG + Intronic
1094466619 12:30760653-30760675 TGTGAAATGATATCTCATTGTGG - Intergenic
1094537085 12:31331075-31331097 TCTGAAATGATTTCACTATCTGG - Intergenic
1095529866 12:43174257-43174279 TGTGACAGAATACCACAAGCTGG - Intergenic
1095713661 12:45317822-45317844 TGTGAGATGATACCTCACTGTGG + Intronic
1097557596 12:61159039-61159061 TGCAAATTGAAACCACAATCAGG + Intergenic
1098201101 12:68056471-68056493 TGTGAAATGGTATCACATTGTGG + Intergenic
1098518542 12:71408018-71408040 TGTGAGGTGATATCTCAATCTGG - Intronic
1098584995 12:72144121-72144143 TCTGGAATGATAGCTCAATCAGG + Intronic
1098660764 12:73090679-73090701 TGTGAAATGATATCTCATTGTGG - Intergenic
1098684934 12:73408047-73408069 TGTGAGATGATACCTCATTGTGG - Intergenic
1099238468 12:80110950-80110972 TGTGAAATGATATCTCATTGTGG + Intergenic
1104186319 12:126435516-126435538 TGTGAAGTGATATCTCAATATGG + Intergenic
1104707824 12:130960892-130960914 TGTGAACTGAGACCTGAATCAGG + Intronic
1105390764 13:19975752-19975774 TGTAAAATGGTACCACACTGTGG - Intronic
1105935298 13:25093011-25093033 TGTGAGATGGTACCTCATTCTGG + Intergenic
1106309473 13:28541418-28541440 AGTGAAATGGTACCAAAAACGGG - Intergenic
1107252890 13:38387125-38387147 TGTGAAATGATATCTCATTGTGG + Intergenic
1107330041 13:39289635-39289657 TGTGAGATGATATCTCAATGTGG - Intergenic
1108216866 13:48194101-48194123 TGTGAAATGATATCTCATTGTGG + Intergenic
1108494555 13:51011306-51011328 TGTGAAATGATATCTCACTGTGG + Intergenic
1109323684 13:60840647-60840669 TGTGAGATGATACCTCACTATGG + Intergenic
1110030316 13:70603364-70603386 TGTGAAATGGTATCACATTATGG - Intergenic
1110086243 13:71384395-71384417 TGTGAGATGATACCTCATTGTGG + Intergenic
1110129276 13:71986990-71987012 TGTGAGATGATACCTCATTGTGG - Intergenic
1110878278 13:80538030-80538052 TGTGAAATGATATCTCATTGTGG + Intergenic
1110910309 13:80953076-80953098 TGTGAGATGATATCACATTGTGG - Intergenic
1111230348 13:85337398-85337420 TGTGAAACAATACCTCAACCAGG + Intergenic
1111726761 13:92020516-92020538 TGTGAAATGATATCTCATTGTGG + Intronic
1112428402 13:99326241-99326263 TGTGAGGTGATACCACATTGTGG + Intronic
1112826793 13:103400734-103400756 TGTGAGATGATATCACATTGCGG + Intergenic
1113392796 13:109914177-109914199 TGTGAGATGATACCTCATTGTGG - Intergenic
1114934302 14:27514581-27514603 TTGGAAATGATACCTCACTCCGG - Intergenic
1114947825 14:27708521-27708543 TGTGAGATGATACTTCATTCAGG + Intergenic
1115899766 14:38132155-38132177 TGTGAAATGATACCTAATTGTGG - Intergenic
1115938620 14:38583655-38583677 TGTGATGTGATACCAGAGTCAGG - Intergenic
1116077758 14:40133646-40133668 TGTGAGATGATACCACATTGTGG + Intergenic
1116185074 14:41590070-41590092 TGTCATATGAGAACACAATCAGG - Intergenic
1116754367 14:48927495-48927517 TGTGAGATGATACCTCACTGTGG - Intergenic
1116859786 14:49984814-49984836 TGTGAAATGATATCTCATTGTGG + Intronic
1116992223 14:51288533-51288555 TGTAAAATGAGACCCCCATCAGG + Intergenic
1117259154 14:54012193-54012215 GGTGAAATATTACCATAATCAGG - Intergenic
1117716218 14:58584371-58584393 TGTAAAATGATACGAGACTCTGG + Intergenic
1117856063 14:60035042-60035064 GGTAAAATGATACCACATTGTGG + Intronic
1118336574 14:64858441-64858463 TATGAAATGAGAACACAGTCAGG + Intronic
1118738455 14:68719864-68719886 TGTGAAATGATATCACTTTGTGG + Intronic
1118943181 14:70357685-70357707 TGTGAAGTGATACCTCATTGTGG - Intronic
1120669329 14:87346197-87346219 TGTTAAATAATATTACAATCAGG - Intergenic
1120748313 14:88173732-88173754 TGTGAAATGATATCTCATTGTGG - Intergenic
1121156087 14:91685763-91685785 TGAGAAATGTTAGCACATTCAGG + Intronic
1121650967 14:95558071-95558093 TGTGAGATGATACCTCATTGTGG - Intergenic
1121845416 14:97168293-97168315 TGTGAAATGATAACACAGGGTGG - Intergenic
1122062346 14:99144377-99144399 TGTGATATGATGCCAGAGTCAGG - Intergenic
1122148389 14:99707897-99707919 TGTGAAATGATCCCCAAAGCAGG + Intronic
1123227072 15:17050026-17050048 TGTGAGATGATATCACATTGTGG + Intergenic
1123453744 15:20396095-20396117 TGAGTAATGATATCACACTCTGG - Intergenic
1123714511 15:23016622-23016644 GGTGAAATGATACCTCATTGTGG - Intronic
1124990010 15:34663480-34663502 TGTGATATAATATCACATTCAGG - Intergenic
1126505637 15:49401291-49401313 TGTGAAATGGTATCACATTGTGG - Intronic
1127677875 15:61260539-61260561 TGTGAAATGGTATCACACTGTGG + Intergenic
1127889735 15:63239200-63239222 TGTAAAATGATAATATAATCAGG - Intronic
1129639585 15:77361513-77361535 GGTGAGATGATACCTCAATGTGG - Intronic
1129879109 15:78995611-78995633 TGTGAAAAAATACCACAAACTGG - Intronic
1130425333 15:83792329-83792351 TGTGAGATGATACCTCATTGTGG - Intronic
1130776121 15:86985323-86985345 TGTAAAATGATACAACTATGAGG - Intronic
1132189782 15:99843075-99843097 TGTGAAATGATATCTCATTATGG - Intergenic
1132411673 15:101583382-101583404 TGTGCAATGATACCTCATTTTGG + Intergenic
1134374826 16:13662106-13662128 TGGGAATTGAGACCACAATCTGG - Intergenic
1135122822 16:19781193-19781215 CGTTAAATAATACCACAATCTGG + Intronic
1135774866 16:25248593-25248615 TATGAAATGATACCTCATTGTGG - Intronic
1136733272 16:32439443-32439465 TGTGAAATGGTACAAAAAGCAGG + Intergenic
1136926191 16:34376795-34376817 TGTGATATTATATCACAATTTGG - Intergenic
1136978383 16:35035012-35035034 TGTGATATTATATCACAATTTGG + Intergenic
1137056874 16:35750198-35750220 TGGGAAATGATTCAACAAGCGGG - Intergenic
1137534864 16:49312392-49312414 TGTGAAATGATGTAACAATGTGG + Intergenic
1137666973 16:50256363-50256385 TGTGAGATGATACCTCACTGTGG - Intronic
1137867157 16:51911294-51911316 TGTTAAATGAAACAATAATCAGG - Intergenic
1139009861 16:62618606-62618628 TGTGAGATGATATCTCAATGTGG - Intergenic
1140420609 16:74815975-74815997 GGAGAAATGATGCTACAATCTGG + Intergenic
1140964288 16:79949680-79949702 TGTGAAATGATATCTCATTGTGG - Intergenic
1142063117 16:88043657-88043679 TGGTAAATTAGACCACAATCAGG + Intronic
1203019811 16_KI270728v1_random:390159-390181 TGTGAAATGGTACAAAAAGCAGG - Intergenic
1203038146 16_KI270728v1_random:663317-663339 TGTGAAATGGTACAAAAAGCAGG - Intergenic
1144036823 17:11374094-11374116 TGTGAAGTGATACCTCATTATGG + Intronic
1144644285 17:16961042-16961064 TGTGAAATGATATCTCATTGTGG - Intronic
1145413095 17:22691433-22691455 TGTGAAATGAAACCACAAATCGG + Intergenic
1147270953 17:39270687-39270709 TGTGAAATGGTAGCAGAATTGGG - Intronic
1150198483 17:63327166-63327188 TGTGAGATGATATCTCAATGTGG - Intronic
1153566434 18:6422917-6422939 TTTGAAATGTTACCAAAATGTGG + Intergenic
1155650948 18:28140963-28140985 TGTGAAATGGTACCTCATTGTGG - Intronic
1157803202 18:50637646-50637668 TGTGACAGAATACCACAGTCTGG + Intronic
1157958324 18:52124267-52124289 TGTAAAATGTTAACACAGTCAGG + Intergenic
1158113993 18:53974464-53974486 TGTGAGATGATATCTCATTCTGG + Intergenic
1158226712 18:55208872-55208894 TGTAAACTGATACCACACTCTGG - Intergenic
1158630582 18:59110758-59110780 TGTGAAATGATCCTGCATTCAGG + Intergenic
1158765144 18:60441716-60441738 TGTGAGATGATACCTCATTATGG + Intergenic
1159377488 18:67612433-67612455 TGTGAGATGGTATCACATTCTGG - Intergenic
1160112983 18:76051260-76051282 TGTCAAAAGATACCAAAAGCTGG - Intergenic
1163537694 19:17886743-17886765 TGTGAAGTGATACCTCACTGTGG + Intronic
1168430666 19:56277028-56277050 TGTGAAGTGATACCTCACTGTGG - Intronic
927440173 2:23109695-23109717 TGTGAGATGATATCTCAATGTGG + Intergenic
929429255 2:41872769-41872791 TGAGAAATGAAACCACATCCTGG + Intergenic
929709810 2:44255505-44255527 TGTGAAGTGATATCTCAATGTGG - Intergenic
930253258 2:49060139-49060161 TGTGAGATGATACCTCATTATGG - Intronic
930731461 2:54732007-54732029 TGTGAAATGATATCTCATTGTGG + Intronic
930984407 2:57567709-57567731 TGGAAAATGCTTCCACAATCAGG - Intergenic
931031985 2:58186857-58186879 TGTGAGATGATATCTCATTCTGG - Intronic
931070858 2:58647963-58647985 TTTGAAATGATACCAGTGTCTGG + Intergenic
931577979 2:63739781-63739803 TGTGAAATGGTATCCCACTCTGG + Intronic
932946066 2:76232861-76232883 TGTGAGATGATATCCCAATGTGG + Intergenic
933547905 2:83738610-83738632 CGTGAAATGATACCTCATTGTGG + Intergenic
933593773 2:84261928-84261950 GGTGAAATGATACCTCATTGTGG - Intergenic
936265453 2:111001814-111001836 TGTGAGCTGATACCATAATGAGG + Intronic
936467771 2:112768640-112768662 TGTGAAATGGTATCACATTGTGG + Intergenic
937108921 2:119347213-119347235 TGTTAAATGACACCACAAGGAGG + Intronic
937713984 2:125010905-125010927 AGTGAAATAACACCACAACCAGG - Intergenic
939072482 2:137560001-137560023 TGTGAGATAATACCTCATTCTGG - Intronic
940091304 2:149922105-149922127 TGTGAGATGATACCTCATTGAGG - Intergenic
940434209 2:153631511-153631533 TGTGAAATGATATCTCATTGTGG + Intergenic
940451041 2:153837208-153837230 TGTGAGATGATACCTCATTGTGG + Intergenic
940734746 2:157437813-157437835 TGTGAGATGATACCTCATTGTGG - Intronic
941637604 2:167952104-167952126 TGTGAGATGATACCTCATTGTGG + Intergenic
941980927 2:171455714-171455736 TGTGAAATGGTACCTCATTGTGG + Intronic
942012870 2:171780937-171780959 TGTGAAGTGATACCACATTGTGG - Intergenic
942848209 2:180451938-180451960 AGTGAAATGATACCCCAGTGAGG + Intergenic
943229378 2:185227641-185227663 TGTGAATTTAGAACACAATCAGG - Intergenic
944032217 2:195248897-195248919 TGTGAAATGATATCTCACTGTGG - Intergenic
945109498 2:206348998-206349020 TGTGAAATGATCTCACATCCAGG + Intergenic
945193169 2:207211580-207211602 TGTGAAATGATATCTCATTGTGG - Intergenic
945587262 2:211681579-211681601 TGTGAATCAAAACCACAATCAGG - Intronic
946851440 2:223910689-223910711 TGTGAAATGGTACCAGATTGTGG - Intronic
1168937880 20:1683187-1683209 TGTGAGATGATACCTCACTATGG - Intergenic
1168987342 20:2061258-2061280 TGTGAGATGATATCACATTGTGG - Intergenic
1169737973 20:8857763-8857785 TATGAAATGATATCTCAATGTGG + Intronic
1169855695 20:10100283-10100305 TGTGTAATGATATCTCAATGTGG - Intergenic
1170234841 20:14090945-14090967 TGTGAAATGATATCTCATTGTGG + Intronic
1170376915 20:15710143-15710165 GGTGAAATGATACCTCATTGTGG - Intronic
1170541679 20:17395323-17395345 TATTAAATGATAGCAAAATCAGG - Intronic
1170638260 20:18128468-18128490 TGTGAAATGGTATCACATTGAGG - Intergenic
1171809763 20:29736291-29736313 TGTGAGATGATATCTCAATGTGG - Intergenic
1171889771 20:30699944-30699966 TGTGAAATGATATCTCATTGTGG - Intergenic
1172472414 20:35209660-35209682 TGTGCAATGATGCCAAAGTCAGG + Intergenic
1172861107 20:38052914-38052936 TCTGAAATTCTCCCACAATCAGG + Intronic
1173213782 20:41059960-41059982 TGTGAATTGAAACCACAGTGAGG + Intronic
1173955903 20:47032290-47032312 TGGGAAATAATACAAAAATCAGG - Intronic
1174923012 20:54724989-54725011 TGTGAGATGATACCTCATTGTGG + Intergenic
1176525144 21:7860604-7860626 TTTAAAATGTGACCACAATCAGG - Intergenic
1176926813 21:14760144-14760166 TGTGAGATGATACCTCAGTGTGG - Intergenic
1177576903 21:22969381-22969403 TTTGAAATAATATCACAAACAGG + Intergenic
1177925390 21:27207935-27207957 TATGAAATGAGACTACACTCTGG - Intergenic
1178659164 21:34490617-34490639 TTTAAAATGTGACCACAATCAGG - Intergenic
1179606804 21:42521860-42521882 TGTAACATGGTACCACAAGCTGG + Intronic
1181718406 22:24752870-24752892 TGTGAAATGATATCTCATTGTGG + Intronic
1182066711 22:27436271-27436293 TCTGAAATGGAACCAGAATCTGG + Intergenic
1182400508 22:30073014-30073036 TGTGAAATGATATCTCATTGTGG - Intergenic
1184308071 22:43622182-43622204 AGTGCCATGATACCAAAATCAGG + Intronic
949293863 3:2497420-2497442 TGTGAAAATGTACCACATTCTGG - Intronic
949350361 3:3119447-3119469 TGTGAGATGATACACCAATGTGG + Intronic
950693534 3:14680069-14680091 TGTGAAATGTTACAGCAGTCTGG + Intronic
955533829 3:59902240-59902262 TGTGAGATGATACCTCACTGTGG - Intronic
955576240 3:60366776-60366798 TGTAAAACAATACCACAGTCTGG - Intronic
957192811 3:77031835-77031857 TATAACATGATACCACAAACTGG + Intronic
957626540 3:82659695-82659717 TGTGAGATGATATCTCATTCTGG + Intergenic
957852787 3:85831532-85831554 TGTGAAATGATATCTCATTGTGG + Intronic
958164261 3:89858918-89858940 TGTGAAAATTTACCACAAACTGG - Intergenic
958938618 3:100285765-100285787 TGTGAAATGATACCTCATTATGG + Intronic
959026573 3:101246637-101246659 TGTGAAATGGTATCACACTTAGG + Intronic
959755542 3:109893548-109893570 TGTGAGATGATATCACATTGTGG + Intergenic
961692422 3:128679849-128679871 CGTGAAATGAGACAACGATCTGG - Intronic
961694672 3:128696362-128696384 TGTGAAGTGATACCTCATTGTGG - Intergenic
961855050 3:129861661-129861683 TGTGAAATGGTACCTCATTGTGG - Intronic
961884122 3:130084638-130084660 TATAAAAAGATACCACAAGCTGG + Intronic
961896351 3:130171282-130171304 TGGGAGATGATACCAGAATTGGG + Intergenic
963084687 3:141426049-141426071 TGTCAAATGATGTCACAATGGGG + Intronic
963206995 3:142646786-142646808 TGATAAATGTTACCAGAATCAGG + Intronic
963440099 3:145329795-145329817 TGTTAAATGATAAAACAAGCTGG + Intergenic
964122831 3:153204059-153204081 GTTGAAATGATACCATAACCAGG - Intergenic
964633108 3:158833676-158833698 TGTGCTATGACACCACAATTAGG + Intergenic
964859996 3:161191013-161191035 TGTGAGATGATACCTCATTTTGG + Intronic
966078256 3:175965320-175965342 TGTGAGATGATATCACATTGTGG - Intergenic
966102661 3:176291848-176291870 TGTAAATTGAAATCACAATCGGG - Intergenic
966304529 3:178515602-178515624 TGTGAGATGATACCTCATTGTGG + Intronic
966356661 3:179087210-179087232 TGTGAAATGATATCTCATTGAGG - Intergenic
966972580 3:185058966-185058988 AGTGAGATGATACCACACTGTGG - Intergenic
969283690 4:6189330-6189352 TCTGGACTGATACAACAATCAGG + Intronic
969404882 4:6984366-6984388 TGTGACAGGAGACCACAATGAGG - Intronic
970778885 4:19711249-19711271 TTTGAAATAATACCAAAGTCTGG + Intergenic
970957062 4:21825086-21825108 TGTGAAATAATTCCAGAATGTGG - Intronic
971737886 4:30480688-30480710 TGTGAAATGATATCTCACTGTGG - Intergenic
971945296 4:33267602-33267624 TGTGAATTAAAACAACAATCAGG + Intergenic
972078912 4:35124373-35124395 TGTGAAATGGTATCTCAATGTGG + Intergenic
972300198 4:37778185-37778207 TGTGAAATAAAACTATAATCAGG - Intergenic
972309942 4:37871308-37871330 TGTGAAATAATACCTCATTGTGG - Intergenic
972433695 4:39011196-39011218 TGTGAAATGGTATCACATTGTGG - Intronic
972970431 4:44568139-44568161 TGTTAAATTATTCCACAATGAGG + Intergenic
973922391 4:55701238-55701260 TGTGAGATGATACCCCATTGTGG - Intergenic
975127788 4:70801554-70801576 TGAGGAATGATACCACAGTGAGG + Intronic
976964709 4:91022710-91022732 TGTGAAATGATATCTCATTATGG + Intronic
977017713 4:91713951-91713973 TGTGAGATGATACCTCATTGTGG - Intergenic
977326767 4:95583700-95583722 TGTGAAATGGTACCTCACTGGGG - Intergenic
977481464 4:97582857-97582879 TGTGAAATGCTATCATAAGCTGG + Intronic
977801208 4:101234435-101234457 TGTGAGATGGTACCACATTGTGG + Intronic
978113643 4:104992894-104992916 TGTGAGATGATATGACAATGTGG + Intergenic
979199598 4:117961234-117961256 TGTGAGATGATACCTCATTGTGG - Intergenic
979557737 4:122069106-122069128 TGGGAGATGGTACCACATTCTGG + Intergenic
980215666 4:129849948-129849970 TGTGAGATGATACCTCATTGTGG + Intergenic
980288675 4:130815077-130815099 TGTGAGATGATACCTCATTGTGG + Intergenic
980565443 4:134533453-134533475 TGTTAAATCATACTATAATCTGG - Intergenic
981456955 4:144963502-144963524 TGTGAAATGATATCTCATTGTGG - Intergenic
982284086 4:153716238-153716260 TGTGAAAGGATTCCTCAATGTGG - Intronic
982603482 4:157483358-157483380 TGTGTGATGATACAACAATGTGG - Intergenic
983004000 4:162459628-162459650 TGTGAAATGGTATCACATTGTGG + Intergenic
983825993 4:172261084-172261106 TCTAATATAATACCACAATCAGG - Intronic
984160379 4:176245337-176245359 TGTGAGATGATACCTCATTGTGG - Intronic
984458747 4:180006651-180006673 TGTGAAATGATATCCCATTGTGG - Intergenic
986106803 5:4667539-4667561 TTTGAAATGATGGCACCATCTGG + Intergenic
986312369 5:6561774-6561796 TGTGAGATGATATCTCACTCTGG - Intergenic
987458054 5:18171166-18171188 TGTGAAATGATATCTCATTGTGG - Intergenic
987605439 5:20129011-20129033 TGAGAAATGAGAACACAATAAGG + Intronic
988332983 5:29866685-29866707 TGTGAAATGATATCTCATTGTGG + Intergenic
989124288 5:38036289-38036311 TGGGACCAGATACCACAATCTGG + Intergenic
989332533 5:40276745-40276767 TGTGATATTAGACCACAATTTGG + Intergenic
989477438 5:41890604-41890626 TATGATGTTATACCACAATCAGG - Intergenic
991335299 5:65540427-65540449 TATGAAAAGATACCACAATAGGG - Intronic
992067753 5:73123208-73123230 TCTGAAATCACACCACAATGAGG - Intronic
993322788 5:86494858-86494880 TGTGAGATGATACCTCACTGTGG + Intergenic
994282936 5:97927492-97927514 TGTGAGATGATATCTCATTCTGG + Intergenic
994285930 5:97967299-97967321 TTTGAAATTATACAACAATTAGG - Intergenic
994721819 5:103389446-103389468 TGTGAAATGACACCAGAATCTGG - Intergenic
994957476 5:106551994-106552016 TGTGAAATGATATCTCATTGTGG - Intergenic
995357605 5:111257436-111257458 TGTGAGATGATATCTCAATGTGG - Intronic
995695270 5:114872185-114872207 TGTGAGATGATACCTCATTGTGG - Intergenic
996043863 5:118848556-118848578 TGTGAAATGTTACCCCATTGTGG - Intronic
996331254 5:122331531-122331553 TGTGACAAAATACCATAATCTGG + Intronic
996694089 5:126374269-126374291 TGTGAAATGGTAACTCAATGTGG + Intronic
996770595 5:127081540-127081562 TGTGAAGTGATACCTCATTGTGG - Intergenic
996964999 5:129297569-129297591 TGTGAGATGATACCTCATTGTGG + Intergenic
999476928 5:151908732-151908754 TGTTAAATGAAAACAAAATCAGG + Intronic
999942185 5:156554934-156554956 TGTGAAATGATATCTCATTGTGG + Intronic
1004860691 6:19801902-19801924 TGTGCAGTGATACCTCACTCTGG - Intergenic
1005247228 6:23901291-23901313 TGTGAAATGAAACCAGAGTAAGG - Intergenic
1006807925 6:36800504-36800526 TGAGAATTGATTCCACAATTAGG + Intronic
1007754603 6:44090774-44090796 TGTGAAATGATAGCTCATTGTGG - Intergenic
1008234892 6:49033180-49033202 TGTGAAGTGGTACCACATTGTGG - Intergenic
1008567240 6:52781394-52781416 TGTCAAATGATGCCCTAATCAGG - Intergenic
1010128039 6:72457011-72457033 TGTGAGATGATAGCTCAATGTGG + Intergenic
1010509970 6:76706286-76706308 TGTGAAATGATACCTCATTGTGG + Intergenic
1010806151 6:80239301-80239323 TGTGAGATGATATCTCAATGTGG + Intronic
1011105205 6:83771993-83772015 TGTGAAATGGTACCTCATTGTGG + Intergenic
1011367005 6:86593772-86593794 TGTGAAGAGATACAACATTCAGG + Intergenic
1011379805 6:86731029-86731051 TGTGAGATGATACCTCATTGTGG - Intergenic
1012047878 6:94301650-94301672 TGTGAGATGATATCACATTGTGG - Intergenic
1012295764 6:97521192-97521214 TGTGTAATGATATCACACTGTGG - Intergenic
1012941563 6:105421202-105421224 TCTGTAATGATACCACACTGTGG - Intergenic
1013020338 6:106208969-106208991 TGTGTAATGATATCACATTGTGG - Intronic
1013085105 6:106850134-106850156 TGGGAACTGATACCACAGTCAGG + Intergenic
1013573277 6:111451724-111451746 TTAGAAATCAAACCACAATCTGG + Intronic
1013848474 6:114484215-114484237 TGTGAAATGATATCTCATTGTGG - Intergenic
1016545735 6:145221301-145221323 TGTGAGATGATACCTCATTGTGG - Intergenic
1016638603 6:146323290-146323312 TGTGAAATGATATCTCATTGTGG + Intronic
1019064535 6:169285613-169285635 TGTGAAATGACACAAAAATAGGG - Intergenic
1019971586 7:4545632-4545654 TATGAAGTGATACCTCATTCTGG + Intergenic
1020568780 7:9830145-9830167 TGGCAAATGATACCTCAACCAGG + Intergenic
1021807731 7:24373770-24373792 TGTGAAATGAGAAGACCATCTGG + Intergenic
1022632143 7:32095314-32095336 TGTGAAGTCAGACAACAATCAGG + Intronic
1022723451 7:32960444-32960466 TGTGAAATGATATCTCATTGTGG + Intronic
1023037016 7:36140402-36140424 TGTGAATTAATTCCACAATATGG - Intergenic
1023558524 7:41448363-41448385 TCTGAAATAGTACCACTATCAGG - Intergenic
1024408938 7:49016209-49016231 TGTGAAATGGTACCTCATTGTGG - Intergenic
1024727314 7:52212628-52212650 TGTGAAATGGTACCTCATTGTGG - Intergenic
1024923779 7:54590837-54590859 TCTGAAATGATCCCAAAATGTGG - Intergenic
1025050181 7:55727473-55727495 TGTGAAATGATATCTCATTGTGG - Intergenic
1027848612 7:83419631-83419653 TGTGAGATGATACCTCATTGTGG + Intronic
1027994313 7:85405207-85405229 TGTGAAATGGTATCTCAATGTGG - Intergenic
1028483951 7:91337950-91337972 CGTGTAATGTTACCACAATGAGG + Intergenic
1028633375 7:92960691-92960713 TGTGAAATGGTAGCACACTATGG - Intergenic
1028652291 7:93162859-93162881 ACTGACATCATACCACAATCGGG + Intergenic
1028699934 7:93765710-93765732 TGTGAGATGATACCTCATTGTGG - Intronic
1028835612 7:95371497-95371519 TGTGAAATGGTATCTCATTCTGG + Intronic
1029885745 7:103869208-103869230 TGTGAAGTGATACAATAAACAGG + Intronic
1030731799 7:112999086-112999108 TGTGAAATGATATCTCATTACGG - Intergenic
1030853227 7:114517051-114517073 TGTGAGATGATACCTCATTGTGG + Intronic
1030947695 7:115745643-115745665 CCTGAAATGATACAAAAATCTGG - Intergenic
1031828275 7:126594035-126594057 TGTGAAGTGATACCTCATTATGG - Intronic
1032273542 7:130433539-130433561 CCTGTAATGATACCACAAACAGG - Intronic
1032549266 7:132769401-132769423 TGTGAAATGATGCCACAGCCTGG - Intergenic
1032814977 7:135463973-135463995 TGTGAGATGATACCTCATTGTGG - Intronic
1033267987 7:139902807-139902829 TGTGAAATGATATCTCATTGTGG + Intronic
1034031802 7:147774780-147774802 TGTAACAAGATACCACAACCTGG - Intronic
1035066814 7:156111173-156111195 TGTAAAATGAGACAACAATGAGG + Intergenic
1035786042 8:2261978-2262000 TCTGAAATGATTCCCCATTCTGG - Intergenic
1035806765 8:2459738-2459760 TCTGAAATGATTCCCCATTCTGG + Intergenic
1038555443 8:28510017-28510039 TGTAAAATGGTACCACCATATGG - Intronic
1038762632 8:30398622-30398644 TTTAAAATGAGACCACAGTCAGG + Intronic
1039588424 8:38726962-38726984 TGTCAAATGCTACCACAAATTGG - Intergenic
1040089971 8:43387631-43387653 TGTGAAGTTATACCACAGTCAGG - Intergenic
1040094295 8:43429149-43429171 TGTGAGATGATATCACATTGTGG - Intergenic
1040100198 8:43493219-43493241 TGTGAGATGATATCACATTGTGG - Intergenic
1040100518 8:43497602-43497624 TGTGAAATGATACCTCATTCTGG + Intergenic
1040120252 8:43676340-43676362 TGTGAAATGAATCCACACTTTGG - Intergenic
1040401908 8:47059897-47059919 TGTGAAGTTATGCCACAGTCAGG + Intergenic
1040429680 8:47327147-47327169 TGTGAAATGATACCTTATTAAGG + Intronic
1042833963 8:73061185-73061207 TGTGAGATGATACCTCATTGTGG - Intergenic
1043236119 8:77869312-77869334 TGTGAGATGATACCTCACTGCGG - Intergenic
1043352062 8:79373584-79373606 TGTAAAATGATACCTCATTGTGG - Intergenic
1043652059 8:82608509-82608531 TGTGAAATGATATCTCATTGTGG + Intergenic
1044175388 8:89114470-89114492 TGTGAAATGGTATCACATTGTGG - Intergenic
1044451930 8:92346006-92346028 TGTGAAATCATGCTACCATCTGG - Intergenic
1045119489 8:99020185-99020207 TATGAAATGATATCTCAATGTGG + Intronic
1045508151 8:102793270-102793292 TGTAACAAAATACCACAATCTGG - Intergenic
1048378183 8:133841018-133841040 TGTGAAATGATATCTCATTGTGG + Intergenic
1048464005 8:134648094-134648116 TGTGAAATGATACCACAATCAGG - Intronic
1048942121 8:139409356-139409378 TGTGAAATCATATCTCAATGTGG + Intergenic
1049940586 9:542350-542372 TGTGAGATGATACCTCACTGTGG - Intronic
1050167233 9:2778082-2778104 TGTGAAATGATATCTCATTGTGG - Intronic
1050399598 9:5237749-5237771 TGTGAAATGATACCTAATTGTGG - Intergenic
1050910571 9:11064394-11064416 TGTAAAATGTAACCACAATTTGG + Intergenic
1051470221 9:17431253-17431275 GGTGAGATGATACCTCAATGTGG + Intronic
1051884929 9:21881671-21881693 TGTGAAGTGATATCTCAATGTGG - Intronic
1052515890 9:29479001-29479023 TGTGAAGTGATACCTCAGTATGG + Intergenic
1052875768 9:33561238-33561260 TGTGAAGTGATACCACAAGGTGG + Intronic
1053500243 9:38583105-38583127 TGTGAAGTGATACCACAAGGTGG - Intergenic
1055587661 9:77772215-77772237 TGTTAAAGGATATCACAGTCAGG - Intronic
1055589684 9:77798919-77798941 TGTGTAATAACACCACAATCAGG + Intronic
1057029197 9:91761034-91761056 TGTGACAAGTTACCACAAACAGG + Intronic
1057418716 9:94889890-94889912 TGTGAATTAAAACCACAATGTGG - Intronic
1057679651 9:97167531-97167553 TGTGAAGTGATACCACAAGGTGG - Intergenic
1057722141 9:97541042-97541064 TGTGAAATGGTATCTCATTCTGG + Intronic
1057753766 9:97813336-97813358 TGTGAAATGATATCTCATTGTGG + Intergenic
1058209926 9:102154134-102154156 TGTGAGATGATACCTCATTGTGG + Intergenic
1058383016 9:104399355-104399377 TGTGAAATGATATCTCATTTTGG + Intergenic
1058559305 9:106207526-106207548 TGTGAAGTGATACCTCATTGTGG + Intergenic
1059696655 9:116736275-116736297 TGAGAAATAACACCACAATCTGG - Intronic
1059719197 9:116942931-116942953 TGTGAAATGGGACCACAAAGAGG - Intronic
1186373803 X:8975913-8975935 TGTGAAGTGATACCTCATTGTGG - Intergenic
1187264016 X:17714411-17714433 TGAGTGATGATTCCACAATCAGG + Intronic
1187430371 X:19218516-19218538 TGTGAAGTGATACCATACTATGG + Intergenic
1188473349 X:30564447-30564469 TGTGAAATGATAGAACACTTGGG + Intronic
1188651707 X:32638645-32638667 TGTGAAATAAAATCACAATTAGG + Intronic
1188780249 X:34274495-34274517 TGTAAAATGATACCTCATTGTGG + Intergenic
1188967693 X:36575484-36575506 TGTCAAATGATAACATATTCAGG + Intergenic
1188995547 X:36880726-36880748 TGTGAGATGATGCCACAATCCGG + Intergenic
1189015214 X:37089861-37089883 TTTAAAATGAGACCACAGTCAGG + Intergenic
1189090976 X:38082339-38082361 TGTGACATGTTACCACTCTCAGG + Intronic
1191074815 X:56441428-56441450 TGTGAGATGATACCTCATTGTGG - Intergenic
1191891157 X:65942863-65942885 TGTGAGATGATACCTCATTTTGG + Intergenic
1192014678 X:67316696-67316718 TGTGAAATGATATCTCATTGTGG - Intergenic
1193399438 X:81025281-81025303 TGTGAGATGATATCACATTGTGG - Intergenic
1193592036 X:83401196-83401218 TGTGAGATGATATCACATTGTGG - Intergenic
1193609659 X:83614344-83614366 TGTGAAATGATATCTCACTGTGG - Intergenic
1193612557 X:83650267-83650289 TGTGAGATGATATCTCATTCTGG + Intergenic
1193854687 X:86585352-86585374 TGTGAAATGGTATCTCAATGTGG + Intronic
1194241970 X:91460967-91460989 TGTGAAATGATATCTCATTGGGG - Intergenic
1194316549 X:92384026-92384048 TGTGAGATGATACCTCATTGTGG + Intronic
1194525540 X:94972663-94972685 TGTGAAATGATATCTCATTGTGG + Intergenic
1194536696 X:95114038-95114060 TGTGAAATGATATCTCATTGTGG + Intergenic
1195022768 X:100846264-100846286 TGTGAAATGATACCACACTCGGG - Intronic
1195203253 X:102569912-102569934 TGTGAAGTGATACCTCAGTGTGG - Intergenic
1195463465 X:105154077-105154099 TGTGATGTGATACCAAAGTCAGG + Intronic
1196566228 X:117208192-117208214 TGTGAGATGATACCTCAATGTGG - Intergenic
1196574090 X:117298454-117298476 TGTGAAATGTTATCACATTGTGG + Intergenic
1197264811 X:124357683-124357705 TGTGAAATGATATCTCATTGTGG + Intronic
1197314586 X:124949199-124949221 TGTGAAAGGATTTGACAATCAGG + Intronic
1197958342 X:131977134-131977156 TGTGAAATGGTATCACATTGTGG + Intergenic
1198217847 X:134573057-134573079 TGTGAAATCAAACCATAATAAGG + Intronic
1199387964 X:147245396-147245418 TGTGAAATGATATCTCATTGTGG - Intergenic
1199443302 X:147893598-147893620 TGTGAAGTGATACCACATACGGG - Intergenic
1199479184 X:148279149-148279171 TGTGAAACGATATCACATTGTGG - Intergenic
1199479450 X:148282103-148282125 TGAGATATGAAACCACCATCAGG + Intergenic
1199922446 X:152422471-152422493 TGTTAAATGTAACCACTATCAGG - Intronic
1200624725 Y:5497346-5497368 TGTGAGATGATACCTCATTGTGG + Intronic
1201278916 Y:12323999-12324021 CGAAAAATGATACCACAATCTGG - Intergenic
1201382513 Y:13398817-13398839 AGTGAAGTGATACCACATTGTGG - Intronic
1201609146 Y:15821613-15821635 TGTGAGATGATACCTCATTGTGG - Intergenic
1201745689 Y:17370749-17370771 TGTAAAATGATATCTCAGTCTGG + Intergenic
1202056158 Y:20833115-20833137 TGTGAGATGGTACCACATTGTGG + Intergenic