ID: 1048468448

View in Genome Browser
Species Human (GRCh38)
Location 8:134686335-134686357
Sequence GCCCCCAACCCAGGATAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048468448_1048468454 -2 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468454 8:134686356-134686378 GCTGGGACCAGAGACTTCTGGGG No data
1048468448_1048468455 4 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468455 8:134686362-134686384 ACCAGAGACTTCTGGGGTGCAGG No data
1048468448_1048468458 6 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468458 8:134686364-134686386 CAGAGACTTCTGGGGTGCAGGGG No data
1048468448_1048468452 -4 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468452 8:134686354-134686376 GGGCTGGGACCAGAGACTTCTGG No data
1048468448_1048468453 -3 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468453 8:134686355-134686377 GGCTGGGACCAGAGACTTCTGGG No data
1048468448_1048468457 5 Left 1048468448 8:134686335-134686357 CCTGGTTATCCTGGGTTGGGGGC 0: 1
1: 0
2: 3
3: 14
4: 153
Right 1048468457 8:134686363-134686385 CCAGAGACTTCTGGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048468448 Original CRISPR GCCCCCAACCCAGGATAACC AGG (reversed) Intronic
900591535 1:3462458-3462480 CCCCCCAACCCAGCAGAGCCTGG + Intronic
902217165 1:14941527-14941549 CCCCCCAACCCAGGCTGCCCTGG - Intronic
903193674 1:21669884-21669906 GCCCCCGCCCCAGCCTAACCCGG + Intergenic
907266109 1:53262417-53262439 GCCCCCAACCCAGGAAAGGCAGG + Intronic
907749862 1:57252700-57252722 GCACCCAACCCAGGAAAACGGGG + Intronic
908006208 1:59731878-59731900 GCCTCAAACCTAGGATAAACAGG - Intronic
912461147 1:109832400-109832422 GCCCCCAGTCCAAGAGAACCAGG - Intergenic
912627046 1:111213994-111214016 GCCCCCAAACCAGGAATGCCAGG - Intronic
912628967 1:111229907-111229929 GCACCCAAGCCAGGAGATCCAGG - Intronic
914414407 1:147466454-147466476 GCACCCAACACAGGAGCACCTGG - Intergenic
914826320 1:151140062-151140084 GCCCCGAAACCAGGATAATGGGG + Exonic
915457135 1:156048425-156048447 ACCCCCACCCCAGGCAAACCTGG - Intronic
916673940 1:167050510-167050532 GGCCCCAAGCCAGAATATCCAGG + Intergenic
924003358 1:239578784-239578806 GTCCCCAACCCAGAATCTCCAGG + Intronic
924862990 1:247945669-247945691 GCACCCAATCCAGGAGCACCCGG - Intronic
924937963 1:248788371-248788393 GCCACCCACCCAGGATAACAGGG + Intergenic
1063016280 10:2080926-2080948 GCCCCTACCCCAAGATAATCTGG - Intergenic
1063262786 10:4409185-4409207 GCCCCCAACTCAGGAACAGCAGG + Intergenic
1063432189 10:6000184-6000206 GCCCCCAACAGAGGAGCACCTGG + Intergenic
1063506507 10:6605045-6605067 TCCCGCAACCCAGGGTACCCAGG - Intergenic
1067207935 10:44235522-44235544 GCCCCAAACCAAGCAAAACCAGG - Intergenic
1068506076 10:57900658-57900680 GCCCCAAACCAATGATGACCAGG + Intergenic
1069867833 10:71514574-71514596 GCCCCCAGCTCAGGAGAAGCTGG + Intronic
1070719626 10:78747089-78747111 GCCCCCAGCCCAGGCTGCCCTGG + Intergenic
1076917182 10:133430116-133430138 GCCTCCAGCCCAGGAGAAGCTGG - Intergenic
1076937277 10:133574875-133574897 GCCTCCAGCCCAGGAGAAGCTGG - Intergenic
1083884858 11:65567907-65567929 GCTCCCAGCCCAGGAGATCCAGG - Intergenic
1089140582 11:116280732-116280754 TCCCCCACCCCAGGAAAACCTGG + Intergenic
1089379101 11:118014915-118014937 GCCTTCATCCCAGGATAATCAGG - Intergenic
1089781758 11:120878108-120878130 GCCCCCAACCCAGGCCAGCAAGG + Intronic
1090750315 11:129741073-129741095 GCCCCCTTCCCAGGCTGACCGGG + Intergenic
1092118790 12:6029224-6029246 GCACCCAACACAGGAGCACCTGG + Intronic
1094842510 12:34348009-34348031 GGCCCAAACCCAGGATCACAGGG + Intergenic
1098342569 12:69467962-69467984 ACCCCCAACCCAGTATTATCTGG + Intergenic
1102518634 12:113465834-113465856 ACCCCCAACCCTGGAGAGCCCGG - Intronic
1103931481 12:124453193-124453215 GCTCCCAGCCCAGGCTAGCCGGG + Intronic
1104404617 12:128507049-128507071 GCCCCAAAGCCAGGTAAACCAGG - Intronic
1105210416 13:18253913-18253935 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1108086277 13:46796858-46796880 GCCTCCAACCTAGTGTAACCCGG - Intronic
1109375549 13:61486878-61486900 ACCCCCAAACCAGGATTAGCTGG - Intergenic
1114568355 14:23648552-23648574 GTCCCAAACCCAGGAAGACCTGG - Intergenic
1119638306 14:76294344-76294366 ACCCCCAACCCAGGGTCAGCTGG + Intergenic
1119676491 14:76559554-76559576 GGGTCCAATCCAGGATAACCTGG - Intergenic
1120269982 14:82299342-82299364 GCCACCAGCCCAGGAAAAGCAGG + Intergenic
1122341020 14:101028561-101028583 GCCGCCTACCCTGGATACCCCGG - Intergenic
1126100347 15:45114931-45114953 GCTCCCCATCCAGGATATCCTGG + Intronic
1127099169 15:55546984-55547006 CCTCCAAAGCCAGGATAACCAGG + Exonic
1127122674 15:55785216-55785238 GTACCCAGCCCAGGATAACAGGG - Intergenic
1127895539 15:63295589-63295611 GCCCCCAACCAAGAATCATCTGG - Intronic
1132498203 16:273704-273726 GCGCCCAACCCAGGCTACCCGGG - Intronic
1133250783 16:4479366-4479388 GACCCCAAACAAGGATCACCTGG - Intronic
1136665454 16:31807980-31808002 GCCGCCATCCCAGGATACCCAGG - Intergenic
1145103583 17:20096833-20096855 CCTCCCAACCCAGGGTATCCAGG - Intronic
1149607709 17:57936463-57936485 GCCCCCAGCCCAGGATGGCAGGG + Intronic
1151679332 17:75615335-75615357 GCCCCCAGCCCAGACTTACCTGG - Intergenic
1152134092 17:78493917-78493939 GACCCCAACCCAGTACATCCTGG - Intronic
1152305206 17:79516378-79516400 GCCCCCTGCCCTGGAGAACCAGG + Intergenic
1152923651 17:83078256-83078278 GCCCCCAGCCCAGGAAAGCTGGG - Intergenic
1153009197 18:522506-522528 GCCCCCAAACCAGGATAAACTGG - Intergenic
1154284282 18:13036799-13036821 CCCCCCATCCCAGGAAACCCCGG - Intronic
1159280913 18:66284278-66284300 CACCCCAACCCAGGATCACCTGG + Intergenic
1162932864 19:13965999-13966021 GTCCCCAACCCAGGGTCACTGGG + Intronic
1163464760 19:17460866-17460888 GCACCCAACCCAGGTTACCATGG - Exonic
1164703532 19:30303167-30303189 GTCCCCATCCCAGGAGACCCTGG - Intronic
1164796722 19:31039656-31039678 TCCCACAACCCAGACTAACCTGG - Intergenic
1167826481 19:51978221-51978243 TCCCTCAACCCAGGAACACCAGG + Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
926720718 2:15958194-15958216 GCCCTCAACCCAGGGAAACAAGG - Intergenic
930586203 2:53269780-53269802 GCACCCAACACAGGAGCACCCGG + Intergenic
932112513 2:69013671-69013693 CCCCCCACCCCAGGCTAAGCGGG + Intronic
938968080 2:136406328-136406350 GCCCTCAGCCCAGGAAGACCAGG + Intergenic
945720845 2:213416669-213416691 GCCCCCACCCCGGGATAGCCAGG - Intronic
948430177 2:237913716-237913738 CCCCCCAACCCAGGTTGGCCCGG - Intergenic
948929768 2:241124458-241124480 ACCCCCAACTCAGAATAGCCGGG + Intronic
1170965992 20:21072185-21072207 GACCCAACCCCAGGAAAACCTGG + Intergenic
1172121872 20:32603337-32603359 GCCCCCAACCCAGGAGGCCCAGG - Intronic
1174046274 20:47736176-47736198 GCCCTCCACCCAGGATGACACGG + Intronic
1174361295 20:50030278-50030300 GCTCTCAGCCCAGGATAGCCGGG + Intergenic
1175618673 20:60424697-60424719 CCCCACCACCCAGGATATCCTGG + Intergenic
1175678493 20:60967414-60967436 CCCCGCAACCCAGAATTACCTGG - Intergenic
1180765841 22:18345490-18345512 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
1180780470 22:18516888-18516910 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1180813188 22:18774209-18774231 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1180940563 22:19657578-19657600 GCCCCCACCCCATGAACACCAGG - Intergenic
1181199363 22:21208525-21208547 GCCTCCAGCCCAGGATGCCCTGG + Intronic
1181400395 22:22647332-22647354 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1181648970 22:24248459-24248481 GCCTCCAGCCCAGGATGCCCTGG + Intergenic
1181702374 22:24628430-24628452 GCCTCCAGCCCAGGATGCCCTGG - Intronic
1181942190 22:26486869-26486891 GACCCCAAGCCAGGAAAAACTGG - Intronic
1182748570 22:32624236-32624258 GCCCCCAACCCAGGCCTCCCTGG - Intronic
1183964256 22:41431872-41431894 GGCCCCCATCCAGGATAACGAGG - Intergenic
1184590838 22:45482224-45482246 GCCCACATCCCAAGATTACCTGG + Intergenic
1184695032 22:46134220-46134242 GCCCAGACCCCAGGATCACCAGG - Intergenic
1185121883 22:48976381-48976403 TGCCTCAACCCAGGAAAACCAGG + Intergenic
1185127287 22:49018143-49018165 GACCCCAACCAAGGCTATCCAGG - Intergenic
1203227462 22_KI270731v1_random:86381-86403 GCCTCCAGCCCAGGATGCCCTGG - Intergenic
950551445 3:13668656-13668678 GCCCCCAACCCAGGATAATGGGG + Intergenic
954274106 3:49531486-49531508 GCCCCCAACCACGGCTATCCAGG + Exonic
954328141 3:49874824-49874846 TCCCCCAACCCTGGAGAACCTGG - Intergenic
955830154 3:62992898-62992920 ACCCCCACCCCAGGGTTACCAGG - Intergenic
956716862 3:72087049-72087071 GCCCAAAACCCAGGACAAACAGG + Intergenic
960758540 3:121047526-121047548 GCACCCAACACAGGAGTACCCGG - Intronic
965299426 3:166991048-166991070 GCCCGTAACTCAGGGTAACCAGG + Intergenic
968451565 4:678481-678503 GCCCCCAACCCCAGCTACCCAGG + Intronic
969052850 4:4385605-4385627 GCCCCCAACCCAGGGAAAGCGGG - Intronic
969119818 4:4899894-4899916 GCCCCCAGCCCTGGCTAAGCTGG + Intergenic
974741990 4:66019249-66019271 GCACCCAACACAGGAGCACCTGG - Intergenic
979057255 4:116012654-116012676 GTACCCAACCCTGGATATCCCGG + Intergenic
985070460 4:186162524-186162546 GCCACCAGCCCAGGGTGACCTGG - Intronic
985785651 5:1892570-1892592 GGCCTCAACCCAAGATGACCGGG - Intergenic
986122718 5:4857181-4857203 GCCTCCAACCCTGAACAACCAGG + Intergenic
986277490 5:6290422-6290444 GACCCCAACCCAGTCTCACCTGG - Intergenic
987271522 5:16314447-16314469 ACCCCCAAGCCTGGATACCCAGG + Intergenic
991198590 5:63962516-63962538 GCCTCCAACCCAGCAAAACTGGG + Intergenic
992507791 5:77405407-77405429 ACCCCCAACCTAGCAAAACCTGG - Intronic
995016725 5:107318340-107318362 GCCACAAACCCAGGAACACCTGG + Intergenic
995720762 5:115129593-115129615 GCCCTAAACCAAGGATTACCAGG + Intronic
999062848 5:148654267-148654289 GACCCCAGCCCCGGATCACCTGG + Intronic
999661663 5:153870859-153870881 ACCCTCAAACCCGGATAACCCGG - Intergenic
999812719 5:155143088-155143110 GCCCCCAACCCTGCATCCCCAGG + Intergenic
1000137409 5:158366028-158366050 GCCCCTGACACAGGAGAACCTGG - Intergenic
1002294861 5:178224583-178224605 GTCCCCAAGCCCGGATAACATGG - Intronic
1005980359 6:30831617-30831639 GCCCCCAACTCAGGGGCACCAGG - Intergenic
1006104356 6:31707616-31707638 GCCCCAGACCCTGGAAAACCAGG + Exonic
1006627086 6:35405207-35405229 GCCACCACACCCGGATAACCAGG + Intronic
1008104248 6:47425450-47425472 TCCCCCAACCCAGGACAGACAGG - Intergenic
1009336309 6:62494498-62494520 GCACCCAACACAGGAACACCCGG + Intergenic
1010298839 6:74234135-74234157 GCCCCTAACCCTGGCTAACTTGG - Intergenic
1014704409 6:124728025-124728047 GCACCCAACACAGGAGCACCCGG + Intronic
1014849972 6:126329058-126329080 GCACCCAACACAGGAGCACCCGG + Intergenic
1015480419 6:133702291-133702313 TCCCCCAACCCAGGATGACCAGG + Intergenic
1017040217 6:150302207-150302229 GCCCTCATCCGGGGATAACCTGG - Intergenic
1019481812 7:1270386-1270408 GTCCCCACTCCAGGACAACCAGG + Intergenic
1023831158 7:44039686-44039708 GCCCCTAACCTAGCAGAACCTGG - Intergenic
1024258456 7:47556982-47557004 GCCCCCCACAGACGATAACCAGG + Intronic
1028467119 7:91164882-91164904 GACCCCAACCTTGGATCACCAGG - Intronic
1029278283 7:99420434-99420456 GCCCCCAAGCCAGAATCACTGGG + Intronic
1029715449 7:102322965-102322987 GCCTCCCACCCAGGATTACTCGG - Intergenic
1029741486 7:102493992-102494014 GCCCCTAACCTAGCAGAACCTGG - Intronic
1029759478 7:102593161-102593183 GCCCCTAACCTAGCAGAACCTGG - Intronic
1029776845 7:102689071-102689093 GCCCCTAACCTAGCAGAACCTGG - Intergenic
1031251751 7:119391408-119391430 ACCCCCACCCCAGTATATCCAGG - Intergenic
1034571020 7:151956435-151956457 CCCCGCAACCCAGCACAACCAGG + Exonic
1034945671 7:155260278-155260300 GATCCCAGCCCAGGAGAACCTGG + Intergenic
1035299053 7:157885329-157885351 GCCCCCAGCCCAGGCCCACCTGG - Intronic
1035492886 7:159295409-159295431 GACCCCAACCCAGGTTGCCCAGG - Intergenic
1037998351 8:23369401-23369423 GGCCCCAAACCAGGATGAGCAGG + Intronic
1039455733 8:37704836-37704858 GCCACCATCCCAGGAAAACCTGG - Intergenic
1044935986 8:97293790-97293812 GCTCCCTGCCCAGGATCACCAGG + Intergenic
1047228034 8:122973136-122973158 CACCCCAACCCAGGAGAGCCAGG + Intronic
1047256572 8:123217754-123217776 GTCCCCAAGGCAGAATAACCTGG - Intergenic
1048468448 8:134686335-134686357 GCCCCCAACCCAGGATAACCAGG - Intronic
1049393020 8:142381741-142381763 GTCCCCAACCCCAGATGACCTGG + Intronic
1049601125 8:143508168-143508190 GCCCACACCACAGGAAAACCAGG + Intronic
1049679191 8:143909908-143909930 GCCCCCAACCAAGGCTTCCCAGG - Intergenic
1049697545 8:143991269-143991291 CCCCCCAACCCTGGATATCCGGG + Exonic
1050920040 9:11188796-11188818 CCACCCAAGCCAGGGTAACCTGG - Intergenic
1059071268 9:111139017-111139039 GCCCCCCACCCCGGATACCCAGG + Intergenic
1062598304 9:137308993-137309015 GCCCCCGACTGAGGATGACCAGG + Intronic
1203491886 Un_GL000224v1:114652-114674 GCACCCAACACAGGAGGACCCGG - Intergenic
1203504510 Un_KI270741v1:56523-56545 GCACCCAACACAGGAGGACCCGG - Intergenic
1191646863 X:63491276-63491298 GCACCCAACACAGGAGCACCTGG + Intergenic
1191823868 X:65342234-65342256 GCACCCAACACAGGAGCACCTGG + Intergenic
1193580983 X:83262368-83262390 GCACCCAACATAGGAGAACCTGG + Intergenic
1194878437 X:99219471-99219493 GCCCACTGCCCAGGATACCCAGG - Intergenic
1195670283 X:107463942-107463964 GCCCCAAACTCAGGACTACCTGG - Intergenic
1196513584 X:116544240-116544262 GCACCCAATACAGGAGAACCTGG - Intergenic
1199947335 X:152679898-152679920 GCTGCCAACCCAGGACCACCCGG + Intergenic
1199962345 X:152788556-152788578 GCTGCCAACCCAGGACCACCCGG - Intergenic
1200360995 X:155606065-155606087 GCACCCAACACAGGAGCACCCGG + Intronic