ID: 1048468876

View in Genome Browser
Species Human (GRCh38)
Location 8:134689513-134689535
Sequence CTGAATTAGGGGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 414}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048468876 Original CRISPR CTGAATTAGGGGAAGGAGGC TGG (reversed) Intronic
901757605 1:11450861-11450883 CTGATGTAGGGGATGGGGGCAGG - Intergenic
901825399 1:11858172-11858194 CTGGAATGGGGGAAGGCGGCCGG + Intronic
902628302 1:17689470-17689492 GGGAGGTAGGGGAAGGAGGCAGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903443486 1:23405727-23405749 ATGCATTAGGGGAGGGAGCCAGG + Intronic
903765379 1:25730827-25730849 CTGAATCAGGTGAAGGGTGCAGG - Intronic
903815795 1:26063515-26063537 CTTTATCAGGGGATGGAGGCAGG - Intronic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904963626 1:34354737-34354759 CTGAATTAAGGTAAGGGGGTTGG - Intergenic
904980644 1:34498210-34498232 CCAAAATAGGGCAAGGAGGCTGG - Intergenic
905491121 1:38344557-38344579 CTGAAGTAGGGGACGGAATCGGG + Intergenic
906535215 1:46547668-46547690 CTGACATAGGGGCAGCAGGCAGG + Exonic
907849978 1:58247151-58247173 CAGAATGGGGGCAAGGAGGCTGG + Intronic
908393638 1:63705607-63705629 CTGACTTGGGGCAAAGAGGCTGG - Intergenic
911002372 1:93180013-93180035 CTGGGTTAAAGGAAGGAGGCTGG + Intronic
911670068 1:100597809-100597831 CTGGATAAGGGGATGGAGGATGG + Intergenic
912568365 1:110605156-110605178 CTGCATTGGGGGAAGGTGGCTGG + Intronic
912663872 1:111561501-111561523 ATGTATTGGGGGAAGGAGGGAGG + Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
914412475 1:147444265-147444287 GTGAGGTAGGGGAAGGAGGGAGG + Intergenic
914847730 1:151292193-151292215 CTGGGTTTGGGGAAGGAGTCAGG + Exonic
915566198 1:156714471-156714493 ATGAATTTGGGGGAGGTGGCTGG - Intergenic
916404302 1:164482337-164482359 CTAAATCAAGGCAAGGAGGCTGG - Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916874907 1:168958790-168958812 TTGAGATAGGGGAAGGAGGAGGG - Intergenic
917665117 1:177218715-177218737 CTGACTTAGGGGAGAGAGGAAGG + Intronic
918081333 1:181209932-181209954 CGGAATTAGAGGAATGAGCCTGG - Intergenic
920045816 1:203131673-203131695 CTGAGTTAGGGAAAGGCTGCTGG + Intronic
920278211 1:204824290-204824312 CAGCATTAAGGGAAGGAGGGAGG - Intergenic
921260453 1:213381459-213381481 CTGAATGAGAGGAGGGGGGCAGG + Intergenic
922072148 1:222205013-222205035 CTGTAGTAGGGAAAGGAGGCTGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922378553 1:224996592-224996614 CTGAGTTAGGGTAGGGAAGCTGG + Intronic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
923649838 1:235864178-235864200 CTGCAGTAGGGGAGGGAGACTGG - Intronic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924431708 1:244002913-244002935 CTGAATTGGGGGAAGGAATATGG + Intergenic
924498236 1:244611054-244611076 ATAAAATAGGGGAGGGAGGCTGG - Intronic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1064578914 10:16773633-16773655 CTGTATTACGTGGAGGAGGCAGG - Intronic
1064739417 10:18416918-18416940 CAGAATTAGGGCAAGGACCCAGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067448001 10:46364729-46364751 CTGTATCTGGGAAAGGAGGCTGG - Intergenic
1067589377 10:47496032-47496054 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067636503 10:48004111-48004133 CTGTATCTGGGAAAGGAGGCTGG + Intergenic
1067748243 10:48952664-48952686 CTGCATTAGGAGGAGGAGGGTGG - Intronic
1068223337 10:54072515-54072537 ATGAATTACGGGAAGGAGAAAGG + Intronic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1070276584 10:75013060-75013082 ATGTCTTTGGGGAAGGAGGCTGG - Intronic
1071397535 10:85238420-85238442 CTAGATGAGGGGCAGGAGGCAGG + Intergenic
1071608619 10:87015939-87015961 CTGTATCCGGGAAAGGAGGCTGG - Intergenic
1072813957 10:98486543-98486565 GTGAGTCAGGGAAAGGAGGCTGG + Intronic
1072853407 10:98921454-98921476 CTGAATTAGGGGTAGACAGCTGG + Intronic
1073110706 10:101061634-101061656 CTGCATAAGGGGGAGGCGGCAGG - Intergenic
1073420686 10:103421499-103421521 CTGATTCAGGAGGAGGAGGCTGG - Exonic
1074331230 10:112511706-112511728 TTGAATTAGGAGGAGGAGGAGGG - Intronic
1074488845 10:113919683-113919705 TTGAATTTGGGGAAGGGGGTAGG + Intergenic
1075079326 10:119372146-119372168 CTGAGCTAGGGGATGGAGGTAGG + Intronic
1075449136 10:122536069-122536091 GCGTATTGGGGGAAGGAGGCTGG + Intergenic
1076271295 10:129154524-129154546 CTCAATAAGGGACAGGAGGCAGG - Intergenic
1076311875 10:129514014-129514036 CTGAATTAGAGGAAAAATGCTGG - Intronic
1076751381 10:132545191-132545213 CTGATTTTGGGGGAAGAGGCTGG + Intronic
1077355313 11:2114175-2114197 CTGAGTTTGGGGCAGGAGGTGGG - Intergenic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1078508568 11:11969038-11969060 ATGAATTAGAGGAGGGTGGCTGG + Intronic
1078555680 11:12324156-12324178 TTGTATTAGGGAAAGCAGGCTGG + Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1081650294 11:44819100-44819122 CTGGATCTGGGGAAGGAGTCAGG + Intronic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1084912618 11:72403301-72403323 CTGATTTAAGGGAAGGAGAGAGG - Intronic
1085068188 11:73517387-73517409 CTGCATGAGGGGAAGGGGGGTGG - Intronic
1086370671 11:86152498-86152520 CAGGACTAGGGGAGGGAGGCAGG + Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088461325 11:110086516-110086538 CTGAACTAGCAGAAGAAGGCAGG - Intergenic
1088908199 11:114170560-114170582 CTGGTTTGGGGGAAGGAGGAGGG - Intronic
1089147043 11:116336679-116336701 CTGAATAAAGGGAAGGGAGCTGG - Intergenic
1089427752 11:118393890-118393912 CTGAATTAGAAAAAGCAGGCTGG - Intronic
1090317525 11:125807052-125807074 CTGACTGAGGGCCAGGAGGCAGG + Intergenic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090669784 11:128938092-128938114 CTGAATTTGGGGAAAGGGGGTGG + Intronic
1090905490 11:131070938-131070960 CTTAATAAGGGGAAGGAGGTAGG - Intergenic
1091462915 12:659374-659396 CTGCATTTTGGGAAGGAGCCAGG + Intronic
1092534776 12:9377708-9377730 GTGGATTAGGGGAAGGAGCTTGG - Intergenic
1092652802 12:10652980-10653002 CTGAAATAGGGAAAGGAGTCAGG + Intronic
1092800995 12:12166799-12166821 ATGAATTAGGAAAATGAGGCTGG + Intronic
1095191099 12:39258926-39258948 CTGAATTAGAACAAGGAGTCTGG + Intergenic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096542748 12:52317415-52317437 CTGGCTCAGGGGAAGGATGCAGG + Intronic
1096777411 12:53972803-53972825 CAGGATTGGGGGAAGGAGGAGGG - Intergenic
1097158158 12:57027505-57027527 GTGAGTTAAGGGAAGGAAGCGGG + Intronic
1097257792 12:57693903-57693925 CTGAAATTGGGGAACGAGGAGGG + Intergenic
1098040776 12:66352301-66352323 CTGAAGTAGAGGAAGGAGCAGGG + Intronic
1098119716 12:67223069-67223091 AGGAATGAGGGGAAAGAGGCGGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1102514616 12:113437977-113437999 CTGAAGTCAGGGAAGGGGGCAGG - Exonic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102693574 12:114780699-114780721 CTAATTTCGGGGAAGGAAGCGGG + Intergenic
1102959695 12:117084709-117084731 CTGAGTCAGGGGAGGGAGGCTGG - Intronic
1103317297 12:120066454-120066476 CTGGGTTGGGGGAAAGAGGCAGG + Intronic
1103359501 12:120345572-120345594 CTGAAGCAGGGGACGGTGGCAGG - Exonic
1105325915 13:19370587-19370609 CTGAATCAAGGCAAGGGGGCCGG + Intergenic
1105489019 13:20869450-20869472 CTTAATTTGGGAAAGGGGGCTGG + Intronic
1105867592 13:24474507-24474529 CTGAATCAAGGCAAGGGGGCCGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1106281585 13:28278195-28278217 ATGAATTGGGGGATGGAGGGTGG + Intronic
1106707831 13:32300586-32300608 ATGAATAAGGGGCAGGAAGCAGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1109371374 13:61424460-61424482 TTGAATTTGGGGAAGGAGAGAGG + Intronic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1111159974 13:84382356-84382378 CTGAAGTAGTGGCAGGAGACAGG - Intergenic
1111662315 13:91226433-91226455 ATGATCTAGGGGAAGGAGGGAGG + Intergenic
1113040608 13:106100561-106100583 CTGGCTTAGGGGGAGAAGGCAGG + Intergenic
1113740789 13:112711075-112711097 CGTATTTGGGGGAAGGAGGCAGG + Intronic
1114645830 14:24255579-24255601 TGGGATCAGGGGAAGGAGGCCGG - Intronic
1115006477 14:28491685-28491707 ATGAATTTTGGGAAGGGGGCAGG - Intergenic
1115508881 14:34120343-34120365 CTGAGTTAGGGCAAGGGGGCTGG - Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1116454502 14:45103660-45103682 ATGAAATAGAGGAAGCAGGCAGG + Intronic
1116855281 14:49946536-49946558 ATGAAACAGGGGAAGGACGCTGG - Intergenic
1116868064 14:50047371-50047393 GTGAATCAGGGGAAGGAAGCTGG + Intergenic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117410990 14:55450921-55450943 CTGAGCTGGGGGCAGGAGGCAGG + Intronic
1117543230 14:56769169-56769191 TTAAAATAGGGGAAGTAGGCCGG + Intergenic
1117730591 14:58718321-58718343 CTGAACTGGGGGAGAGAGGCAGG - Intergenic
1117846995 14:59921604-59921626 ATACATTAGGAGAAGGAGGCTGG + Intronic
1118261409 14:64250708-64250730 CTGAGTTCGGGGAAGGAGGAGGG - Intronic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1122090401 14:99334667-99334689 GTGATTTAGGGGAAAGCGGCAGG + Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1123712843 15:23002491-23002513 CTGAATCAGGGGAAGTGGCCCGG - Intronic
1123991601 15:25687618-25687640 CTGAATGAGGCGAAGGAGGATGG - Intronic
1124345533 15:28919241-28919263 CCGAGTCAAGGGAAGGAGGCAGG + Intronic
1124367998 15:29087728-29087750 CTGGAGTGGGGAAAGGAGGCAGG - Intronic
1125463313 15:39926701-39926723 CTGAAATGGGGGCAGGTGGCGGG + Intergenic
1126176805 15:45743399-45743421 CAGAAATTGGGAAAGGAGGCAGG - Intergenic
1126795036 15:52253784-52253806 CTGCATTAGGCCAAAGAGGCTGG - Intronic
1127600675 15:60533724-60533746 AGGAATCAGGGTAAGGAGGCTGG - Intronic
1127890217 15:63243684-63243706 CAGAATTTGGGGAAGGGGGCAGG + Intronic
1128250895 15:66163707-66163729 CTGAGTTATGGGAAGGCGGGCGG + Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1128334174 15:66775535-66775557 CTGGATCAGGGCCAGGAGGCAGG + Intronic
1128968659 15:72086691-72086713 CTGCAATAGGGGAAGGGAGCAGG + Intronic
1129188787 15:73926069-73926091 CGGGAGTACGGGAAGGAGGCTGG + Intronic
1129351776 15:74959495-74959517 GTGAATTAGGGTAATGTGGCAGG + Intronic
1129552664 15:76470354-76470376 CTGAATCTGGGGAAAGAGTCAGG + Intronic
1129602981 15:77011020-77011042 GTGAAGGAGGGGAAGCAGGCGGG + Intronic
1129758364 15:78112163-78112185 CTGAATAATGGGCAGGGGGCGGG - Intronic
1130060461 15:80566244-80566266 CAGAGTTAGAGGAAGAAGGCAGG - Intronic
1130402307 15:83568633-83568655 CTGAAATACGGGAAGGAGCTCGG + Exonic
1132367631 15:101269099-101269121 CTGACTAAGGGGAAGAAGTCAGG - Intergenic
1133087253 16:3374606-3374628 CAGAATTGGGGGAAAGAAGCAGG + Intronic
1133605190 16:7379966-7379988 CTAACTTTGGAGAAGGAGGCAGG - Intronic
1135540440 16:23325754-23325776 CTAAATTCAAGGAAGGAGGCTGG + Intronic
1136120025 16:28126898-28126920 CTGAAGTAGGGGGAGGGAGCAGG - Intronic
1137715655 16:50596839-50596861 CTGAAGGAGGGGCAGGAGGGAGG + Intronic
1137745535 16:50817490-50817512 CTGGATTAGCGGCAGGAGGTGGG + Intergenic
1137830311 16:51537921-51537943 CTGAATTAGAAGGAGGAGTCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137995653 16:53208360-53208382 CTGAATGAGTGGGAGGAGGAGGG + Intronic
1139164120 16:64546017-64546039 GTGAATGAGACGAAGGAGGCAGG - Intergenic
1140792067 16:78401537-78401559 ATGATTTAGGGGAAAGAGTCTGG + Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1141635987 16:85314154-85314176 CTGCCTCAGGGGAGGGAGGCTGG - Intergenic
1141729546 16:85812502-85812524 CTGCATTTCTGGAAGGAGGCGGG - Intergenic
1142420365 16:89966200-89966222 CTGCATTGGGGGAAGGATGGGGG - Exonic
1143476751 17:7207524-7207546 CGGAGGTAGGGGGAGGAGGCGGG + Intronic
1143497559 17:7321165-7321187 CTGAACTGGGGGAAGGAGGCTGG + Exonic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1143924990 17:10361738-10361760 CTGAGTTTGGGGAAGAACGCAGG + Intronic
1144085407 17:11803876-11803898 CTGAATCAGGAGAGAGAGGCTGG + Intronic
1146010570 17:29191236-29191258 CTGAAGGAGAGGAAGGAGGAAGG - Intergenic
1146092585 17:29894826-29894848 CTTAATTGGGGGAAGGTGGAAGG - Intronic
1146414672 17:32620790-32620812 CTGATGTAGGGGGAGGAGCCAGG + Intronic
1146435990 17:32848323-32848345 AAGAATTAGGGGAAAGGGGCAGG + Intronic
1146454576 17:32998923-32998945 CTGAATTAGGTGGAGGAGGATGG - Intergenic
1146694265 17:34896867-34896889 CTGAATTAGAGGAAGAAAGGTGG - Intergenic
1147210458 17:38870027-38870049 GTTTATTAGGGGAAGGAGGGCGG + Exonic
1147654507 17:42081162-42081184 CTGGGTTAGGGGAAGAAGGATGG + Intergenic
1147723020 17:42550258-42550280 GGGCACTAGGGGAAGGAGGCAGG + Exonic
1148052372 17:44775551-44775573 CGGGAGGAGGGGAAGGAGGCGGG - Intronic
1148213873 17:45824079-45824101 CTGGACTGGGGGAAGGAGGTGGG + Intronic
1148222156 17:45870661-45870683 CTGAACAAGGGGCAAGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1149389369 17:56173986-56174008 CTGTATCAGAGAAAGGAGGCAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150767772 17:68015762-68015784 CTAAAGGAGGGGAAGGAGGTGGG + Intergenic
1151813651 17:76460104-76460126 CTGAAGTAGGTGACTGAGGCTGG - Intronic
1151824682 17:76517635-76517657 CTGAAGTCGGGCAAGGAGACTGG + Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1154504643 18:15023656-15023678 CTGAATTATGGAGAGGAGGTGGG - Intergenic
1155806634 18:30178348-30178370 AGGACATAGGGGAAGGAGGCAGG + Intergenic
1157193715 18:45602406-45602428 TTGAAGCAGGGCAAGGAGGCAGG + Intronic
1157328949 18:46689211-46689233 CTGAATGAGTGGCAGAAGGCAGG - Intronic
1157733423 18:50024635-50024657 CTGTAATAGGGGCAGGAGCCAGG + Intronic
1157850299 18:51042380-51042402 CTGAAGTAAGGGAGGGAGGCAGG - Intronic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159257796 18:65970864-65970886 CTGAATTAAGGGAAAGGGGTGGG + Intergenic
1159941797 18:74413939-74413961 CTAAATGAGCAGAAGGAGGCCGG - Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1161439399 19:4281994-4282016 CTGAAGTGGGCGAAGGAGGGAGG + Intronic
1161927593 19:7312817-7312839 AAGAATTAGGGAAAGAAGGCTGG - Intergenic
1161984478 19:7646198-7646220 GGGATTGAGGGGAAGGAGGCTGG - Intronic
1163220328 19:15914082-15914104 CTGAACTGGGGGTAGGAGCCTGG - Intronic
1164048873 19:21567067-21567089 GTGAACTAGGGAAACGAGGCTGG + Intergenic
1167105463 19:47427769-47427791 TTTAAGTGGGGGAAGGAGGCAGG - Intergenic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167241659 19:48347300-48347322 CTGAATTAGTGGAAGGAGAGAGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925341916 2:3143611-3143633 GTGAATTAGGGGAAGAAGAAAGG - Intergenic
925554158 2:5110895-5110917 CTGAAGTAGGGGAGAGAGGAGGG + Intergenic
925819267 2:7783550-7783572 CTGGATGAGGGGAAAGAGACAGG + Intergenic
926036346 2:9638728-9638750 ATGACTAAGGGGAAGGAGGGCGG - Intergenic
926340845 2:11903128-11903150 CTGATTTTGAGGTAGGAGGCAGG + Intergenic
926417660 2:12665651-12665673 CTGAAGTAGAGGAAGGAAGGTGG - Intergenic
927672067 2:25076974-25076996 ATGAATTTGGGGAAGGAGGCAGG - Intronic
928212609 2:29334712-29334734 CTCCATTCGGGGAAGGAGACTGG - Intronic
928314988 2:30238025-30238047 TTGAATTAGGGTAAGGAAGAAGG - Intronic
928599269 2:32887125-32887147 ATGATGTAGGGGAAGGAGGGAGG + Intergenic
929110514 2:38402792-38402814 CTGAGTTAGGAGAATCAGGCAGG - Intergenic
929490518 2:42392190-42392212 ATGCATTAGAGGAAGGTGGCAGG - Intronic
930330656 2:49979000-49979022 AAGACTTAGGGGAAGGAGGTCGG + Intronic
930388940 2:50736111-50736133 CTGAAATACGGGAAGCAGGGGGG - Intronic
931680304 2:64741340-64741362 TTAAATTAGGGGAAAAAGGCTGG - Intronic
932301790 2:70672621-70672643 CTGAGTTGGGGCAAGGAGCCGGG + Intronic
932463996 2:71901785-71901807 CTGAATTGGGGGAAGGGCCCTGG - Intergenic
932578225 2:72974422-72974444 CTGGATGAGGGGAAGGAGGCTGG - Intronic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
934925922 2:98381725-98381747 CTGGGCTGGGGGAAGGAGGCTGG + Intronic
936450062 2:112627145-112627167 CTGACTTAGGGTAAGATGGCAGG + Intergenic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
936795972 2:116204406-116204428 CTGTATTAGGGGGAGGGTGCAGG + Intergenic
936960096 2:118063998-118064020 CTCAAGTAGGAGAAAGAGGCAGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
938315843 2:130327534-130327556 ATGCAGTAAGGGAAGGAGGCAGG + Intergenic
939337478 2:140849058-140849080 CTTAAGTAGGGGAGGGAGGCCGG + Intronic
940181111 2:150934173-150934195 CTGAAATCAGGGAAGGAGACAGG + Intergenic
943457018 2:188120664-188120686 CTGAATAAGTGGAAGGATTCTGG + Intergenic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
945155528 2:206833711-206833733 CTGAATTAGGGTAAGGGAGACGG + Intergenic
945250846 2:207765782-207765804 TTGAACTGGGGGAGGGAGGCTGG - Exonic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946534858 2:220615924-220615946 CTGTATGAGGGGAATGAGACTGG - Intergenic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947639222 2:231696947-231696969 CTGCATGAGGGGAATGAGGTGGG + Intergenic
947897957 2:233693009-233693031 CTGAAATGAGCGAAGGAGGCAGG - Exonic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948188255 2:236038371-236038393 CTGAATTAGGTCGAGGTGGCAGG - Intronic
948598100 2:239093281-239093303 CTGCTTTCGGGGAAGGTGGCTGG + Intronic
948903648 2:240967929-240967951 CTCAATTAAAGGAAAGAGGCAGG + Intronic
1169410971 20:5370094-5370116 AAGAATGAGGGGCAGGAGGCAGG - Intergenic
1170153511 20:13249332-13249354 CAGAACTAGGGGTGGGAGGCAGG - Intronic
1171330400 20:24332415-24332437 ATAAATGAGGGGAAGGAGACAGG - Intergenic
1171514995 20:25723070-25723092 CTAAATTAGGGGAGGAAGGATGG + Intergenic
1172416709 20:34775035-34775057 ATGAACTAGGGGAAGGGGGTTGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172486407 20:35300601-35300623 CTGACCTGGGGGAGGGAGGCAGG + Intergenic
1172732083 20:37096451-37096473 TTGAGTTAGGAGATGGAGGCTGG + Intergenic
1173857646 20:46260977-46260999 AGGAATTTGGGGGAGGAGGCAGG - Intronic
1173898930 20:46572535-46572557 CTGGCCTAGAGGAAGGAGGCTGG - Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1175322185 20:58096980-58097002 ATGAATGAGGGGCAGAAGGCAGG - Intergenic
1175453845 20:59094823-59094845 CTCAATGAGAGTAAGGAGGCGGG - Intergenic
1175780199 20:61677188-61677210 CTGGAGTAGGGGAAGGAGCAGGG + Intronic
1177196913 21:17912748-17912770 CTGGATCAGGGGTGGGAGGCAGG + Intronic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1178944163 21:36932439-36932461 TTCAATCAGGGGAAGGAGGGTGG - Intronic
1179554498 21:42163590-42163612 CTGGATGAGGGGGAGGAGGAGGG + Intergenic
1179953284 21:44723765-44723787 CAGAACTAGGGAAGGGAGGCGGG + Intergenic
1180394181 22:12314402-12314424 GTGGGTTAGGGGAAGGGGGCAGG - Intergenic
1180405565 22:12550347-12550369 GTGGGTTAGGGGAAGGGGGCAGG + Intergenic
1181624809 22:24116052-24116074 GAGAATTAAAGGAAGGAGGCTGG - Intronic
1181629439 22:24142870-24142892 CTGACTTGGGGGAAGGAGTGAGG - Intronic
1182663426 22:31941255-31941277 CTGTAAAACGGGAAGGAGGCCGG + Intronic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1185212808 22:49581323-49581345 CTGACTTATGGGATGAAGGCTGG + Intronic
949345567 3:3073116-3073138 CTGAAGTAGAGAATGGAGGCTGG - Intronic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
949851120 3:8421441-8421463 CTGCAGTAGGGGTAGGAGGTGGG + Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950931178 3:16790473-16790495 AAGAATTTGGGGAAGCAGGCTGG - Intergenic
951442086 3:22735309-22735331 TTGATTTAGGGGCAGGAGACAGG - Intergenic
951728689 3:25786569-25786591 CTGAAGTGGGGGAAGCAGCCAGG + Intronic
953251676 3:41249750-41249772 CTGACCAAGGGGAAAGAGGCAGG + Intronic
953418812 3:42739344-42739366 ATGTATTGGGGGAAGGAGGTGGG - Intronic
953563125 3:44010567-44010589 CTGAACTAGGGGACTGAGGGGGG + Intergenic
954584588 3:51722257-51722279 CTCAACAATGGGAAGGAGGCAGG + Intergenic
954746813 3:52792074-52792096 CTGATTTTGGGGAGGGAGGATGG + Intergenic
955366863 3:58318228-58318250 CTTAGTTAGGGGAAGGGAGCAGG + Exonic
955531750 3:59880301-59880323 CTGGATGAAGGGAAGGAGCCAGG - Intronic
956816130 3:72910054-72910076 CTGAATCAGGGGAAGGGTGAAGG + Intronic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
959099903 3:101998576-101998598 CTGAATGAGGGAATGGTGGCTGG - Intergenic
959504128 3:107139297-107139319 CTGAATTAGGGGATGGAGTGTGG + Intergenic
960130468 3:114050643-114050665 CTGATGGAGGGGAAGGAGACTGG + Intronic
960134308 3:114090266-114090288 CTGAACTAGGGGCATGAAGCAGG - Intergenic
961056656 3:123794393-123794415 CTGAATGAAGGGAAGGAGGTAGG + Intronic
961386738 3:126527085-126527107 GTGGAATAGGGGAAGGGGGCTGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962949188 3:140202471-140202493 CTGAGTTGGAGGAAGGATGCGGG + Intronic
963156289 3:142100671-142100693 GTGAAGAAAGGGAAGGAGGCAGG - Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
965553052 3:169989376-169989398 CCAAATCAGAGGAAGGAGGCTGG - Intronic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968426441 4:526538-526560 CTGAGTTAATGGGAGGAGGCAGG + Intronic
968524266 4:1048028-1048050 ATGATTTAGGTGAAGAAGGCTGG + Intergenic
969227316 4:5807490-5807512 CTAAAAGATGGGAAGGAGGCAGG + Intronic
969455379 4:7297145-7297167 CTGCATTAGGTGGAGGGGGCTGG + Intronic
971048320 4:22831163-22831185 CTTAATTAGGGGAATGAAGTGGG - Intergenic
973248273 4:48034080-48034102 GAGCATTAGAGGAAGGAGGCTGG + Intronic
974467418 4:62274695-62274717 CTAAATTTGGGGGAAGAGGCTGG - Intergenic
974514970 4:62897213-62897235 ATGAGTTCAGGGAAGGAGGCTGG + Intergenic
977313750 4:95418907-95418929 CTGAAGTCGGGGCAGGAGGCAGG - Intronic
977578582 4:98700619-98700641 CTGAATTAAGGAAAGCAGCCTGG + Intergenic
978082519 4:104611948-104611970 CTGAATTGGGGGCAGGGTGCGGG - Intergenic
978297946 4:107230545-107230567 CTAAATTAGGAGAATGAGGTTGG - Intronic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981468702 4:145103676-145103698 CTGAAAAAGGGGAAGCAGGATGG - Intronic
981724699 4:147834797-147834819 CTGACCCAGGGGAAGGAGACAGG - Intronic
982742612 4:159073625-159073647 CTGGATTAGGAGAGGGAGGATGG - Intergenic
982909487 4:161121136-161121158 CTGAAGCAGGGAAAAGAGGCTGG + Intergenic
984598303 4:181697047-181697069 CCTAATTAGTGGAGGGAGGCAGG - Intergenic
984637979 4:182134416-182134438 CTGAGTTAGGGGAAAGAGAAGGG - Intergenic
985222980 4:187727744-187727766 CTGGATGATGGGAAAGAGGCAGG + Intergenic
985498399 5:224599-224621 CTGGAGCAGGGGGAGGAGGCAGG - Intronic
985865183 5:2508990-2509012 CTGATTCATGGGATGGAGGCTGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987913468 5:24180983-24181005 CTGAATTAGGGGAAGAATCAAGG - Intergenic
990335341 5:54767090-54767112 CTGAATTGAGGGAAAGGGGCTGG - Intergenic
991009730 5:61870378-61870400 GTGAAGTAAGGGAAGGAGACAGG + Intergenic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
991110069 5:62889663-62889685 CTAGATTTGGGGAAGGAGGGTGG + Intergenic
991601368 5:68354564-68354586 CTGGATGAGAGGAAGGAGGTAGG - Intergenic
996854181 5:127986603-127986625 CTGACTTAGGGGAAGGCTGATGG + Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997474965 5:134137547-134137569 CTGATTTAGGGGATTGAGGAGGG + Intronic
997690323 5:135823694-135823716 CTGAATGAGGGGTATGAGGGTGG + Intergenic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998188197 5:139999228-139999250 CGGCATAAGGGGAATGAGGCAGG - Intronic
999236915 5:150104014-150104036 CTGACTTAGGGGTGGGAGGGGGG + Intronic
999519799 5:152339545-152339567 CTTAATGGGGGGATGGAGGCAGG + Intergenic
999980918 5:156957157-156957179 CTAAATTCGGGGAAGGCTGCAGG - Intronic
1001135564 5:169099811-169099833 CTGCATTAGGTCAAGAAGGCAGG + Intronic
1001449968 5:171817133-171817155 CTGATTTGAGGCAAGGAGGCTGG - Intergenic
1001630963 5:173175197-173175219 CTGCATTAAGAGAAGCAGGCTGG - Intergenic
1001650701 5:173314017-173314039 CTGAAGTAGGGGAAGGTGTGTGG + Intergenic
1003550472 6:7098387-7098409 CTGAAGATGTGGAAGGAGGCAGG - Intergenic
1003676585 6:8210324-8210346 CTTATTTAGGGGAAGGAGGTCGG - Intergenic
1005978847 6:30820534-30820556 GTGAATAAGGGCAAGGAAGCAGG - Intergenic
1006256543 6:32837186-32837208 CAGACTTAGGGGTAGGAGGTAGG + Intronic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1009876222 6:69508633-69508655 GTGCCTTAGGGAAAGGAGGCTGG + Intergenic
1010932503 6:81819595-81819617 CCGAGTTGGGGGAAGAAGGCTGG - Intergenic
1011726120 6:90212298-90212320 ATGCATTGGGGGAAGGGGGCAGG - Intronic
1011822915 6:91273805-91273827 ATGAATTAGGCGAAGGAGCCAGG + Intergenic
1012903953 6:105042210-105042232 CTGAATTGGGGGAAGGGGGTAGG + Intronic
1013948962 6:115756262-115756284 TTCAATTTGGGGAAGGAGGAAGG + Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014410877 6:121118764-121118786 CTGACTTTGGGAAAGGAAGCAGG - Intronic
1015211191 6:130701140-130701162 CTGAAAGAGGGGAGGGAGGAAGG + Intergenic
1015277434 6:131398863-131398885 AAGATTTAGGGGCAGGAGGCCGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017139555 6:151178384-151178406 CTTATCTAGTGGAAGGAGGCAGG - Intergenic
1017237262 6:152129782-152129804 CTGAATTCCTGGAAGGAGGGTGG - Intronic
1017575567 6:155798627-155798649 CTGAAGTTGGGGAAGGATACAGG + Intergenic
1017602073 6:156094650-156094672 GAGAAGTAGGGGAAGGAGGAAGG - Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020893255 7:13906114-13906136 CTGAATTAGAGAAAAGAGGCAGG - Intronic
1021962792 7:25889319-25889341 CTGATATAGGGGACGGAGACAGG - Intergenic
1022109434 7:27219504-27219526 CTGAGTTGGGGGAAGGGGGGAGG + Intergenic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1024482129 7:49874829-49874851 CTGAATTAGGGAAGAGGGGCAGG - Intronic
1026373066 7:69721295-69721317 CTGAATCAAGTGAAGGAGGGAGG - Intronic
1026395796 7:69953040-69953062 CTAATTTAGGGGAGGGAGGAGGG - Intronic
1026847308 7:73705369-73705391 CAGAATTGGGGGAGGGGGGCGGG - Intronic
1026989495 7:74575683-74575705 CTGAACTTGGGGAAGGACGGAGG + Intronic
1028456487 7:91043650-91043672 ATGACGAAGGGGAAGGAGGCAGG - Intronic
1029104094 7:98160657-98160679 CTGATTTGGGGGAAGGAGTGTGG + Intronic
1032305512 7:130730223-130730245 CTGAAATATGGGTTGGAGGCTGG - Intergenic
1032496824 7:132368979-132369001 CTGAATTAGGGGAGGGTGGATGG - Intronic
1032613927 7:133445486-133445508 CTGAAGTAGTGGAAAGACGCTGG - Intronic
1036185078 8:6615499-6615521 CTGAGTTGGGGGCAGGAGGCAGG + Intronic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036753333 8:11456767-11456789 CTGGATTAGGGGAGTGCGGCTGG + Intronic
1037236961 8:16731401-16731423 ATGAAGTAAGGGAAGGTGGCAGG - Intergenic
1038670911 8:29582133-29582155 ATCAAGTAGGGGAAGAAGGCAGG - Intergenic
1039901151 8:41753421-41753443 CTGACTGAGGGGAAGGGGTCTGG - Intronic
1040881310 8:52207810-52207832 CCTAATTAGAGGAAGGGGGCTGG + Intronic
1041568977 8:59314321-59314343 TTGACTTAGGGCAAGGAGCCTGG - Intergenic
1042266797 8:66916686-66916708 GTGAATTAGAGGAAGCAGACTGG + Intronic
1044704640 8:94996654-94996676 ATGAATTGGGGGAAGGCGGTGGG - Intronic
1048462895 8:134637469-134637491 CTGAATTTGGGTGAGGAGGAAGG - Exonic
1048468876 8:134689513-134689535 CTGAATTAGGGGAAGGAGGCTGG - Intronic
1049024265 8:139977975-139977997 TTAAATTAGGAGTAGGAGGCTGG - Intronic
1049218487 8:141418257-141418279 GTGATTTTGGGGGAGGAGGCTGG - Intronic
1049552810 8:143268184-143268206 CATCATTAGGGGATGGAGGCTGG + Intronic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1050038933 9:1466816-1466838 CTGAGTTGGAGGAAGGAGGGAGG + Intergenic
1050184413 9:2957759-2957781 CTGAATTCCAGGCAGGAGGCAGG - Intergenic
1051697216 9:19781368-19781390 ATGAAGTAGGGGAAGGTGGAAGG + Intronic
1051789309 9:20782489-20782511 CTGAAAAAGCGGAATGAGGCAGG - Intronic
1052549645 9:29931654-29931676 CTGACTTAGGGGAAAGAGGTAGG + Intergenic
1056435127 9:86568602-86568624 CTGAATTTGGGCAAGGAGGCTGG + Intergenic
1056447337 9:86678580-86678602 CTGAAGTATGGGAGGGAGCCAGG + Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1056763246 9:89429093-89429115 CTGCATTTGGGGAAGGAGCTGGG - Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1059358071 9:113716745-113716767 TTGAATTAAGGCAGGGAGGCTGG + Intergenic
1059450720 9:114370191-114370213 CTGAAAGAGGGGGAGGCGGCGGG - Intronic
1059475106 9:114540306-114540328 CAGAATTATGCAAAGGAGGCCGG + Intergenic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1060692986 9:125681329-125681351 CTGAATTATGGGAAAAAGTCAGG + Intronic
1061777911 9:132978090-132978112 CTGAACTTGGGGAGGGAGGGAGG + Intronic
1187447419 X:19371834-19371856 CTGAAATAAGGGAGGGGGGCCGG + Intronic
1187675596 X:21712996-21713018 ATGCATTATGGGAAGAAGGCAGG - Intronic
1187722446 X:22165435-22165457 CTGAATTGAGGCAAGGGGGCTGG + Intronic
1187988548 X:24842980-24843002 GTGTATTGGGGGAGGGAGGCAGG - Intronic
1188702031 X:33277114-33277136 ATGGATTGGGGGAAGGTGGCAGG - Intronic
1189078494 X:37943385-37943407 TTGAAATGGGGGAAGGAGACTGG + Intronic
1189164408 X:38846453-38846475 CTGAGTTACAGGATGGAGGCTGG + Intergenic
1189851353 X:45179173-45179195 CTTTGTTGGGGGAAGGAGGCTGG - Intronic
1192794304 X:74413252-74413274 CTGAGTTAGGAGAATCAGGCAGG + Intergenic
1195693277 X:107646890-107646912 CTGAACTATGTGAGGGAGGCTGG + Intronic
1195693982 X:107653196-107653218 CTAAAGCAGGGGTAGGAGGCTGG + Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1201236322 Y:11915449-11915471 CTGAATCAGGGCAAAGAGGAAGG - Intergenic
1202143234 Y:21751070-21751092 CTAAAGTAGGGGAAGCAGGAGGG - Intergenic