ID: 1048469334

View in Genome Browser
Species Human (GRCh38)
Location 8:134693330-134693352
Sequence TTAACACAACTGGCCAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048469328_1048469334 21 Left 1048469328 8:134693286-134693308 CCTCACAAAAGCGGGGGCACGCT 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1048469334 8:134693330-134693352 TTAACACAACTGGCCAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048469334 Original CRISPR TTAACACAACTGGCCAAATA TGG Intronic
No off target data available for this crispr