ID: 1048471690

View in Genome Browser
Species Human (GRCh38)
Location 8:134709819-134709841
Sequence AATGAGAAGCCCACTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048471687_1048471690 -7 Left 1048471687 8:134709803-134709825 CCTTTCACCGGAGGCAAATGAGA 0: 1
1: 0
2: 0
3: 9
4: 83
Right 1048471690 8:134709819-134709841 AATGAGAAGCCCACTGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048471690 Original CRISPR AATGAGAAGCCCACTGAGAA GGG Intronic
No off target data available for this crispr