ID: 1048473035

View in Genome Browser
Species Human (GRCh38)
Location 8:134720293-134720315
Sequence AAAACTACTCCCACACTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048473035_1048473039 9 Left 1048473035 8:134720293-134720315 CCACTAAGTGTGGGAGTAGTTTT No data
Right 1048473039 8:134720325-134720347 AAAAGATAACTTAGTATTGTGGG No data
1048473035_1048473038 8 Left 1048473035 8:134720293-134720315 CCACTAAGTGTGGGAGTAGTTTT No data
Right 1048473038 8:134720324-134720346 CAAAAGATAACTTAGTATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048473035 Original CRISPR AAAACTACTCCCACACTTAG TGG (reversed) Intergenic
No off target data available for this crispr