ID: 1048474135

View in Genome Browser
Species Human (GRCh38)
Location 8:134727978-134728000
Sequence GAGACAGGAGCACCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048474135_1048474139 6 Left 1048474135 8:134727978-134728000 CCACTTTTGGGTGCTCCTGTCTC No data
Right 1048474139 8:134728007-134728029 CTGAGCAGACATGCTGTACCAGG No data
1048474135_1048474141 30 Left 1048474135 8:134727978-134728000 CCACTTTTGGGTGCTCCTGTCTC No data
Right 1048474141 8:134728031-134728053 ACAATGTGAGTAATGAGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048474135 Original CRISPR GAGACAGGAGCACCCAAAAG TGG (reversed) Intergenic
No off target data available for this crispr