ID: 1048479909

View in Genome Browser
Species Human (GRCh38)
Location 8:134779862-134779884
Sequence CCACATTTATCCTACCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048479909_1048479913 19 Left 1048479909 8:134779862-134779884 CCCTGAAGGTAGGATAAATGTGG No data
Right 1048479913 8:134779904-134779926 TCTTATAAATACATATAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048479909 Original CRISPR CCACATTTATCCTACCTTCA GGG (reversed) Intergenic
No off target data available for this crispr