ID: 1048480705

View in Genome Browser
Species Human (GRCh38)
Location 8:134789794-134789816
Sequence CTGATGTCTTTGGTCAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048480701_1048480705 19 Left 1048480701 8:134789752-134789774 CCAATGTTACATTGGTTCTTTTT No data
Right 1048480705 8:134789794-134789816 CTGATGTCTTTGGTCAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048480705 Original CRISPR CTGATGTCTTTGGTCAACTC TGG Intergenic
No off target data available for this crispr