ID: 1048480705 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:134789794-134789816 |
| Sequence | CTGATGTCTTTGGTCAACTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1048480701_1048480705 | 19 | Left | 1048480701 | 8:134789752-134789774 | CCAATGTTACATTGGTTCTTTTT | No data | ||
| Right | 1048480705 | 8:134789794-134789816 | CTGATGTCTTTGGTCAACTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1048480705 | Original CRISPR | CTGATGTCTTTGGTCAACTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||