ID: 1048482302

View in Genome Browser
Species Human (GRCh38)
Location 8:134809847-134809869
Sequence GCTACTATTCAACTCACTGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048482302_1048482306 24 Left 1048482302 8:134809847-134809869 CCGACAGTGAGTTGAATAGTAGC No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048482302 Original CRISPR GCTACTATTCAACTCACTGT CGG (reversed) Intergenic
No off target data available for this crispr