ID: 1048482305

View in Genome Browser
Species Human (GRCh38)
Location 8:134809879-134809901
Sequence GGGCACTGTTTCAAGAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048482305_1048482306 -8 Left 1048482305 8:134809879-134809901 CCTAGATTCTTGAAACAGTGCCC No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048482305 Original CRISPR GGGCACTGTTTCAAGAATCT AGG (reversed) Intergenic
No off target data available for this crispr