ID: 1048482306

View in Genome Browser
Species Human (GRCh38)
Location 8:134809894-134809916
Sequence CAGTGCCCACTCAAAGACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048482302_1048482306 24 Left 1048482302 8:134809847-134809869 CCGACAGTGAGTTGAATAGTAGC No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data
1048482303_1048482306 2 Left 1048482303 8:134809869-134809891 CCAGTACCTTCCTAGATTCTTGA No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data
1048482304_1048482306 -4 Left 1048482304 8:134809875-134809897 CCTTCCTAGATTCTTGAAACAGT No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data
1048482305_1048482306 -8 Left 1048482305 8:134809879-134809901 CCTAGATTCTTGAAACAGTGCCC No data
Right 1048482306 8:134809894-134809916 CAGTGCCCACTCAAAGACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048482306 Original CRISPR CAGTGCCCACTCAAAGACCT AGG Intergenic
No off target data available for this crispr