ID: 1048484000

View in Genome Browser
Species Human (GRCh38)
Location 8:134831477-134831499
Sequence CCGGGAGCACCCGTCTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048484000_1048484007 -3 Left 1048484000 8:134831477-134831499 CCCATCCAGACGGGTGCTCCCGG No data
Right 1048484007 8:134831497-134831519 CGGCCTCTCTCACTCCCGGCCGG No data
1048484000_1048484004 -7 Left 1048484000 8:134831477-134831499 CCCATCCAGACGGGTGCTCCCGG No data
Right 1048484004 8:134831493-134831515 CTCCCGGCCTCTCTCACTCCCGG No data
1048484000_1048484009 7 Left 1048484000 8:134831477-134831499 CCCATCCAGACGGGTGCTCCCGG No data
Right 1048484009 8:134831507-134831529 CACTCCCGGCCGGTCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048484000 Original CRISPR CCGGGAGCACCCGTCTGGAT GGG (reversed) Intergenic
No off target data available for this crispr