ID: 1048487341

View in Genome Browser
Species Human (GRCh38)
Location 8:134860524-134860546
Sequence CAAGTTAAACAGTACTCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048487341_1048487346 30 Left 1048487341 8:134860524-134860546 CCTATAGAGTACTGTTTAACTTG No data
Right 1048487346 8:134860577-134860599 GAAAGTGCTTTCCTGCGTCAAGG No data
1048487341_1048487343 6 Left 1048487341 8:134860524-134860546 CCTATAGAGTACTGTTTAACTTG No data
Right 1048487343 8:134860553-134860575 TGGTTCCTCCTTGATCATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048487341 Original CRISPR CAAGTTAAACAGTACTCTAT AGG (reversed) Intergenic
No off target data available for this crispr