ID: 1048488319

View in Genome Browser
Species Human (GRCh38)
Location 8:134868902-134868924
Sequence AAGGTGAACTAACCTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048488314_1048488319 29 Left 1048488314 8:134868850-134868872 CCAGGAAAGGATTGCTCTTCTCC No data
Right 1048488319 8:134868902-134868924 AAGGTGAACTAACCTGTTCCAGG No data
1048488315_1048488319 8 Left 1048488315 8:134868871-134868893 CCTTCCTTCATGACTGAAGACAC No data
Right 1048488319 8:134868902-134868924 AAGGTGAACTAACCTGTTCCAGG No data
1048488317_1048488319 4 Left 1048488317 8:134868875-134868897 CCTTCATGACTGAAGACACAGGA No data
Right 1048488319 8:134868902-134868924 AAGGTGAACTAACCTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048488319 Original CRISPR AAGGTGAACTAACCTGTTCC AGG Intergenic
No off target data available for this crispr