ID: 1048488970

View in Genome Browser
Species Human (GRCh38)
Location 8:134874293-134874315
Sequence CACAGTGTAAGAGGGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048488970_1048488973 -4 Left 1048488970 8:134874293-134874315 CCACATGGCCCTCTTACACTGTG No data
Right 1048488973 8:134874312-134874334 TGTGACAGCTCACTTCTTCAAGG No data
1048488970_1048488974 4 Left 1048488970 8:134874293-134874315 CCACATGGCCCTCTTACACTGTG No data
Right 1048488974 8:134874320-134874342 CTCACTTCTTCAAGGCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048488970 Original CRISPR CACAGTGTAAGAGGGCCATG TGG (reversed) Intergenic
No off target data available for this crispr