ID: 1048491259

View in Genome Browser
Species Human (GRCh38)
Location 8:134895947-134895969
Sequence AGTAAAATGGAGGAACCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048491259_1048491270 23 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491259_1048491266 9 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491266 8:134895979-134896001 CACCATCCTTCTGGTTGTTCAGG No data
1048491259_1048491263 0 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491263 8:134895970-134895992 TACCAGCACCACCATCCTTCTGG No data
1048491259_1048491269 22 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491259_1048491271 24 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491271 8:134895994-134896016 TGTTCAGGCTCCATACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048491259 Original CRISPR AGTAAAATGGAGGAACCTAT GGG (reversed) Intergenic
No off target data available for this crispr