ID: 1048491265

View in Genome Browser
Species Human (GRCh38)
Location 8:134895978-134896000
Sequence CTGAACAACCAGAAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048491265_1048491271 -7 Left 1048491265 8:134895978-134896000 CCACCATCCTTCTGGTTGTTCAG No data
Right 1048491271 8:134895994-134896016 TGTTCAGGCTCCATACATTGGGG No data
1048491265_1048491269 -9 Left 1048491265 8:134895978-134896000 CCACCATCCTTCTGGTTGTTCAG No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491265_1048491270 -8 Left 1048491265 8:134895978-134896000 CCACCATCCTTCTGGTTGTTCAG No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048491265 Original CRISPR CTGAACAACCAGAAGGATGG TGG (reversed) Intergenic
No off target data available for this crispr