ID: 1048491269

View in Genome Browser
Species Human (GRCh38)
Location 8:134895992-134896014
Sequence GTTGTTCAGGCTCCATACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048491258_1048491269 27 Left 1048491258 8:134895942-134895964 CCTCACCCATAGGTTCCTCCATT No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491264_1048491269 -3 Left 1048491264 8:134895972-134895994 CCAGCACCACCATCCTTCTGGTT No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491261_1048491269 12 Left 1048491261 8:134895957-134895979 CCTCCATTTTACTTACCAGCACC No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491260_1048491269 21 Left 1048491260 8:134895948-134895970 CCATAGGTTCCTCCATTTTACTT No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491262_1048491269 9 Left 1048491262 8:134895960-134895982 CCATTTTACTTACCAGCACCACC No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491259_1048491269 22 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data
1048491265_1048491269 -9 Left 1048491265 8:134895978-134896000 CCACCATCCTTCTGGTTGTTCAG No data
Right 1048491269 8:134895992-134896014 GTTGTTCAGGCTCCATACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048491269 Original CRISPR GTTGTTCAGGCTCCATACAT TGG Intergenic
No off target data available for this crispr