ID: 1048491270

View in Genome Browser
Species Human (GRCh38)
Location 8:134895993-134896015
Sequence TTGTTCAGGCTCCATACATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048491265_1048491270 -8 Left 1048491265 8:134895978-134896000 CCACCATCCTTCTGGTTGTTCAG No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491264_1048491270 -2 Left 1048491264 8:134895972-134895994 CCAGCACCACCATCCTTCTGGTT No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491258_1048491270 28 Left 1048491258 8:134895942-134895964 CCTCACCCATAGGTTCCTCCATT No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491261_1048491270 13 Left 1048491261 8:134895957-134895979 CCTCCATTTTACTTACCAGCACC No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491260_1048491270 22 Left 1048491260 8:134895948-134895970 CCATAGGTTCCTCCATTTTACTT No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491262_1048491270 10 Left 1048491262 8:134895960-134895982 CCATTTTACTTACCAGCACCACC No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data
1048491259_1048491270 23 Left 1048491259 8:134895947-134895969 CCCATAGGTTCCTCCATTTTACT No data
Right 1048491270 8:134895993-134896015 TTGTTCAGGCTCCATACATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048491270 Original CRISPR TTGTTCAGGCTCCATACATT GGG Intergenic
No off target data available for this crispr