ID: 1048493812

View in Genome Browser
Species Human (GRCh38)
Location 8:134919126-134919148
Sequence GGGCACATGCTCCTTTGCGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048493812_1048493820 30 Left 1048493812 8:134919126-134919148 CCATCGCAAAGGAGCATGTGCCC No data
Right 1048493820 8:134919179-134919201 CTACCACAGCACAGATAGATAGG No data
1048493812_1048493816 -4 Left 1048493812 8:134919126-134919148 CCATCGCAAAGGAGCATGTGCCC No data
Right 1048493816 8:134919145-134919167 GCCCAAGTGGAGGGAATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048493812 Original CRISPR GGGCACATGCTCCTTTGCGA TGG (reversed) Intergenic