ID: 1048494174

View in Genome Browser
Species Human (GRCh38)
Location 8:134921554-134921576
Sequence CAGGAATGGAACACAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048494164_1048494174 24 Left 1048494164 8:134921507-134921529 CCGAGAAACCTGAAATGACTTGC No data
Right 1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG No data
1048494172_1048494174 -6 Left 1048494172 8:134921537-134921559 CCAGGATGAGGTAGAGGCAGGAA No data
Right 1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG No data
1048494167_1048494174 16 Left 1048494167 8:134921515-134921537 CCTGAAATGACTTGCTCAAGGGC No data
Right 1048494174 8:134921554-134921576 CAGGAATGGAACACAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048494174 Original CRISPR CAGGAATGGAACACAGCTGC CGG Intergenic
No off target data available for this crispr