ID: 1048502620

View in Genome Browser
Species Human (GRCh38)
Location 8:134992560-134992582
Sequence GTCACTGCCACATTGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048502620_1048502623 19 Left 1048502620 8:134992560-134992582 CCTCCTTTCAATGTGGCAGTGAC No data
Right 1048502623 8:134992602-134992624 CGTACCAGTGCTGAGCCACCTGG No data
1048502620_1048502625 23 Left 1048502620 8:134992560-134992582 CCTCCTTTCAATGTGGCAGTGAC No data
Right 1048502625 8:134992606-134992628 CCAGTGCTGAGCCACCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048502620 Original CRISPR GTCACTGCCACATTGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr