ID: 1048504424

View in Genome Browser
Species Human (GRCh38)
Location 8:135007957-135007979
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048504424_1048504428 20 Left 1048504424 8:135007957-135007979 CCATTCCCACTCTGGCTGTGGGA No data
Right 1048504428 8:135008000-135008022 TTGATCACCTACTGTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048504424 Original CRISPR TCCCACAGCCAGAGTGGGAA TGG (reversed) Intergenic
No off target data available for this crispr