ID: 1048506224

View in Genome Browser
Species Human (GRCh38)
Location 8:135024674-135024696
Sequence TGCCCAAGCTCATATAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048506223_1048506224 -3 Left 1048506223 8:135024654-135024676 CCATTGCTTTAAAGCTCACTTGC No data
Right 1048506224 8:135024674-135024696 TGCCCAAGCTCATATAGTTCAGG No data
1048506222_1048506224 24 Left 1048506222 8:135024627-135024649 CCTTGGTACTTGTTAATTCTTAG No data
Right 1048506224 8:135024674-135024696 TGCCCAAGCTCATATAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048506224 Original CRISPR TGCCCAAGCTCATATAGTTC AGG Intergenic
No off target data available for this crispr