ID: 1048508221

View in Genome Browser
Species Human (GRCh38)
Location 8:135039980-135040002
Sequence GCCTTGAAGGAGGATCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048508221_1048508225 -1 Left 1048508221 8:135039980-135040002 CCATGCAGATCCTCCTTCAAGGC No data
Right 1048508225 8:135040002-135040024 CAAGACTAGCTGCTCAGGACCGG No data
1048508221_1048508224 -6 Left 1048508221 8:135039980-135040002 CCATGCAGATCCTCCTTCAAGGC No data
Right 1048508224 8:135039997-135040019 CAAGGCAAGACTAGCTGCTCAGG No data
1048508221_1048508226 17 Left 1048508221 8:135039980-135040002 CCATGCAGATCCTCCTTCAAGGC No data
Right 1048508226 8:135040020-135040042 ACCGGAGCGTGATCAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048508221 Original CRISPR GCCTTGAAGGAGGATCTGCA TGG (reversed) Intergenic
No off target data available for this crispr