ID: 1048509935

View in Genome Browser
Species Human (GRCh38)
Location 8:135053171-135053193
Sequence CTGCAGATACAGAGGGCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048509935_1048509942 24 Left 1048509935 8:135053171-135053193 CCATTGGCCCTCTGTATCTGCAG No data
Right 1048509942 8:135053218-135053240 AGCACAGATGAAAATATCTGGGG No data
1048509935_1048509941 23 Left 1048509935 8:135053171-135053193 CCATTGGCCCTCTGTATCTGCAG No data
Right 1048509941 8:135053217-135053239 AAGCACAGATGAAAATATCTGGG No data
1048509935_1048509940 22 Left 1048509935 8:135053171-135053193 CCATTGGCCCTCTGTATCTGCAG No data
Right 1048509940 8:135053216-135053238 CAAGCACAGATGAAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048509935 Original CRISPR CTGCAGATACAGAGGGCCAA TGG (reversed) Intergenic
No off target data available for this crispr