ID: 1048510107

View in Genome Browser
Species Human (GRCh38)
Location 8:135054574-135054596
Sequence ACGGGTGTGGGGCACCATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1048510107_1048510115 18 Left 1048510107 8:135054574-135054596 CCAGTATGGTGCCCCACACCCGT No data
Right 1048510115 8:135054615-135054637 CAAGGCCTAACTTGAGTGACAGG No data
1048510107_1048510117 26 Left 1048510107 8:135054574-135054596 CCAGTATGGTGCCCCACACCCGT No data
Right 1048510117 8:135054623-135054645 AACTTGAGTGACAGGCAACATGG No data
1048510107_1048510114 0 Left 1048510107 8:135054574-135054596 CCAGTATGGTGCCCCACACCCGT No data
Right 1048510114 8:135054597-135054619 GGTGTCTTCATTTTGTTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1048510107 Original CRISPR ACGGGTGTGGGGCACCATAC TGG (reversed) Intergenic
No off target data available for this crispr